Description :
From Genome Similarity Track
Location :
Scaffold_356:11072- 14358
Sequence
3286 bases(100 bases per row)
TGTCAAGCGACGGTCACGCCACAGTGAATCAGCTCCTCTCTCCAACCGCTCGCAAGGCCCTGCTCCACGTGCTGTCTTCGCGTGATAAGTATATGCCTGG
GTATCGCGCTCGTGCGACTTATGCTCCTGGCCAGTTTTCGCCGTGGTCGTCTCGCTGCTTAGGTTTGGTCACGGTGGGTGGAATGGATTTGGACTTCTTG
TTCCGCCACACTCTCGTCCCAAGCACTACTTGTTCCCGTTTCGAAACCCCGCGCTCGCCCGCCTATCGAGTCCCAATGATCACCACGACTGGTAAACACG
GCGCAAATCACCACTTTATACGGTCAGAGACCATGGGACATCCTGGATCGGCCGATGGCGCCTGTGTATTTTTCGCCCGACTGGCTGGTTTCAAGTCTTG
GTGACTGACTATCATGATTTTAAAGATCATCACCGCCAGGTGCTATGGGAGTCCACCCATGTGCAACCAATCATCGTCGGTCCAAGCCGCGCAAAGAATC
CCGGGTTGAGCGTCTACTATGAAGAAAGGCGTCGTCGACGTTCCCGATCTAGTCCCCGGTGGAAGGCAGTGCTCCGGATCGTGCTGCAGGGGTTGGTCGA
GGGTCGGTGCAACCTCGACATCCTGTTAGACCCTTTCTTCCTGCAATTTTCCGGACGCTTGAAGAAATGCCTGTGACATCCGAGTTTTGGCTGCCGACAA
ACCAACATCCCTAATTTGGCCTCCGCCTTGCGCCTGACGGACTCCGCCGGTCCCTGGCGTAATCAATACCGGACGGCCATCGCTGATCACCCGGGATCGT
CCATCGACCGCCTCACAAACAAGTTCGTGGAGAAGTGATTGTCCGTTTCTGGTATAAAGGACCATGGTGTTTATGGCCGCAGTCATGACCGCATGTCGTA
ACTACTCAATTCGCCTTTGTTGCTCGTTCCATTATCGTTACGTTCGTTAAACATGTGAATCCTCCCCTTTGCCAGCTCGCATGGTCATTGTTGCTTTCCG
CTCACAAAGCAGACGATCACCATTCTTCGTGGTCGAGGTAAGCACCTCTGGTCGCCCTAACATCTGAATTTTCTTCGTTTACTTGCATCACTTCATACCG
ATTCCGATTAGCTCGATCACGTTCAAATTCCTGCAACAATGCACCACAGTTGAGGTTCGCTTCATCCACCCTGGTTTCCTCCTTATGGCCCTTCCACCGG
ACCAGGAACTGTCAGTGTGTTCTTCCATACCGAGTTTCTCGCCCCGACTTCACATCTCTAATGCTGTCCACCTCTTATTCCCCTTCGGCTAAATTGCCTT
TCCAACTGTCCTCCGGCTTCATCAAAATCCACTCGCTCGGTTTCTTCCACCTCCAGCCGTGCAACAGGTTGGTCAGGAAAACTTCGTACCAATTTTAGCT
TAGGTATGTGCACGAGCGGGAATAATCGGTATGGGTTTCCTTGCACTTCCAGCCGTACTGCATGTTCCCCAAACTTCTCGATCACCCGGAATGGGTCATG
CCACATGTGAGCCAGCTTCCTGGCATATCCTTCTTTCACCCGATCCAAATACAGCCACACTTGGCTACCACAGCTTATTCCATGTGGCCCTTGATCAGTG
TTGTGTTGATCAGCCCGGTCCTGAATAGCTTCGTTCAGCCGGTCATTCACGGTGGCCCGGGCACGTTGGTACTGTCGCTGTATCTGATAGCGCCATCTCC
TGGGGTCACGATCACGTGTTTTGGTGCATCCCAACGGAAGGGTTGCTTCCAACGTCGATCGCGGGTCCCATCCGTGGATGGGATAGAACGGGGTATCACT
TCGGAATCGATCATGCGCCGTATTGATGGCGAAGGTCAATCGCTCGGCGTACTCATCCCAATCTTGTTGGTTCACGTCCGTGACATATATCTTGAGCGCC
CTGGTCAATGTTTGGATTATCCGTTCGGCGGTGCCATTGGCCTGAGGCCGATACGCCATTGTAGCACGCTGCTTTTGACCGGCAATACGGTTGAATGCGC
GAAAGAAATCCGACATGAACCCAGGTTCGAGATCATAGCGCATAGATTCGCTCGCCCCAAATCGCCGGAAGACGCATTCTTCATACCCTTCCGCGGTCGT
TTAGGCCGTCCTCGACGAGCTAGCCTTAGCGATCACGTAGCCGGAGACCAAATCAACCCAAAGAAGCAATTCAGTGTTTCCTTTGAATGACCGGGGCAAA
GAAGGGATATGATCCACTGCGATAATCTGGAACGGGTACGTAGCTTGCATGTTCCCCGGGGATTCTCCGCGTAGCGCCGGACATTCCTTCCCGGTTTCGC
AGTCGACGCACTTCCCCACATACTGCCGCACGCTTCTGAACAAACCTCTTCAATGGAAGTGTGATCGCACACGGTGATACGTGCGGCCTACCCCTTGGTG
ACCACCTTCCAGAATTTTGTGGTAGTGGTGTAGAATATCATCTTGAAGCAGCTCCAGGATTACCAAACGAGCGAGCTCAGCACGGTCATCGGGGTTTGTT
GCCGATCGTCGGCAAAAATACAACAATCTGCCTTCATCTACAACGTAGTCTGGGGCAATCACGGCACTTGCTTTTGCTTCTGTAGCACCCGGTTCCGTTA
CATCTCCGACTAAGTAAAGTTTGAGGTTAGCGATCCAACTCTCTTCGTCTTGCACATGTTTTATACGGTCGAGTCGCATCTGCTGTACTACGTCATCGTG
TATAATAATAAACGCCTCACGCCTTCGCATGATCGATCGTGTAATTGCCGCCACCTTGATCACTTGATCATTGCACGCTGGAATCATAAATTCGTCCAGT
CGATTTATGGCGCTCAGATCGTGGAGCTCCTGATCCGCTAGCATAAACATGCCCTTTTCCTGCTGTAAAGCAGTGCTAGCCAGTCGATCCGCACTGATTC
CATTCGCGCTTAACGTGTAAGAACTCATGTGTCGGCCACGACCTAAGTTGATATATGGATTTGAGGCGCAGTGATTGTAACCTTGATGCCTTGCAATCAA
TCTCGCCCCGCATCTGCCTGTTGGCCAGGTTGGAATCCCCACAGATGACCACTCGTCCCCTTGTCTGTTTCGCTAGCAGCTCGCTACTCAGCAGTAACCC
GTGCTACCCTGCCTCGTTCACTGTTAATCGAGTATCAAAACGCGACGCAGCTGACAATTTGGTCCACTCGGGCAATTTCCATATCACTGCACTGTAGGCG
CCCCCTTTTTCTTTATACGTGCTGACCCGTCAGAGCTGAAGACCAACAGCACTTCGACATGTCTGACCGTAGGGCGTGGAATGTTA