Description :
From Genome Similarity Track
Location :
Scaffold_2:1107114- 1109576
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000786Protein of unknown function
Pytul_DAOMBR144PYU1_G000785Protein of unknown function

Sequence
2462 bases(100 bases per row)
TGCGTACACGGAGGCGCAGCTCGTGGTGCTCGTGCTCGCGGTGTTTGTGATCGCCGTGGCGCTGCTGTCATACTTTGTGGTTGCGCCCGAGTACGAGAAG
CGGCTCCATGAACAGTTTGCCGCGTTCCATGAAGAGTCCAAGCTCCAGCACCAGAACGAGCTCGTGACGATGATGAAGAAGACGACGCTCCAGAAGCACA
AATCGCTCGGCTCCTGGGATATGGAGGCCGCGTCCAGCGACGACGACGCGTTCGACCACCACCTCCAGCGGTTGCACGTCGCCAACAGCGTGCTCAGCGG
CTCGGACGACGACGGAAGCTTGTGTTCTTCTACGAACAGACCCCCGATGTCGCTGAACTCGGAGAACCACAGGTCGATGGCCATACGCTTGACGGACGCG
CAACGGGAGCTGCTCGCGCGCCGTCGCAAAAGCGAGTCGGACGCGCTCAAGCACGCGAACGTCTACCGCGCCGAGATGCTGCGGCGCCGCGTGATGCTCA
AGAAGCTCGAAGAGGAGATCAAAGGCGCGATCAAGGAGACGAGCGACGCGCAGCAGCAGTCATCGTCTGCGCCATCGTCCTTGCGCGGTGGCTCGCGGCG
GCTCTCAAACGACGCGCTCAACCTGACGGAGGACCGCGTGAAGATGCTGCAGGAGCACCCGGCCGATTGCGCCCATGAGCTCCGTGTGCTGGCGACACAG
ATGCCCATTACGCGCGCAAACAAGAGTGCAATAGCGGCACGGGGCGCGACGACCACGGCATCATCATCACCGGATGCTGCGGACTCGCGCACGGACGAGG
TCAAGGCCGCACTGCAGACCGTGCACGACGTGCTCTCGTTCTACCTGTCGGTGGACCACCGCGACATGACGAAACTCACGGTGTTTTGCAACTCGCTGCT
GCAGCACGACGGGCTGAACCACCTGCGCGCGTTCGAGGTGTCGTGCGACCAGGACATCCGCTCGCTCTCCACGTCGATCATCGAGAAGGCCGTGCCCGCG
ATCTGGCACTAACCCAAGCACAAACGATGAACCTCCTCCTATTAATTAAAGAAGAAGTATACAAGTACAGAATATAGTTGCATTCACCTACCATCGCAAG
ACTTGAAAACTGAGGGATCCACTTAGTCATGAAAAAAGCCAATCGCCTTAGGGCAATATCCTAGTAGTGTGTGTTTCAATTATGGAGCCGCGTTCGCAGT
TTGCGGAGGCACGCGTTGATGACGATGCGCAGCATGAGGCGAAAGGGCGAACCGCCGCAGAGCATGACACTGCCCACGGCGCCCTTGATCGTCCAGAGCA
CGAGCGTCTTGGGTCCACTCACATCACTTGTGCCGCTGGTGGCAGCGCGATAAAGCGCACCAAGCCGATATGGTCGTTTATGGGGAAGATTCCGACATTG
TGCACCATGTAGCATACCGACTCGACCTTTTCCTCATCTTCACGGGGCAACCCCACCGAGACAATCTTCTCTTGGACGCCGAGCGGTGTCCCGCGCGCAT
GGCCAACGTATCCGTTCGCGGGGTCTCCCTGCGCGAGCACATGCGCCGTGTTGAGCCACACGTACTGGAGCCATGCGTGGAACGTGTTGTTGGCGCTGGC
GTCCACGACGATGGATGCGACCACTTCTGCGCCGCCGTTCGCGGTGTATTCCTCAAGCGCGCGTGGATCTGCGTATCAATGAGCGGCTTCCATTATGCTT
GCAGATCTGCGCCACAGAGTAAATATGTTGAACAAAGTGGCGTCGACCAAAGAGAAGACAGTCGCTCGAGTCGATATTTTGAAAAGTGAACAGCATTTTT
GCAGTGCGTACGCGGCTTCTTACCAACATGACTCCAAAATGGCACATCCAAGGGCGCATTCTTTACGTTGTGCCATGGTCCCTCCCCATTGGGCCTTGGA
TGCCGTGATACTACTGCTTCTTACTGCTTCTTCCCTTCTTTCAGCTTTGACTGCAGACGATGCAGAAAATACGATAATGCGGAGCGCAGCGACACACGTA
GCGTGAATCCGCCACAAAATGCCACATTGCCCACGGTTGACGGTATGATCTTGATCGTCCAGAGCACGAGCGTCTTTGGCGCCGACGGAGACGACGACGC
CGTGTCGGGCACGAAGCGCACGAACGCCGTGTGGTCGCGGATGGGCATGGGGCCGTACTCGCGCAGCTTGTAGCAGATGGACGGGAGCGCGTCGCCGCCC
TCACTCTCGTTATCGCGGGGAAGACCGACCGACACGATCTGCTCGACGATGCCCAGCGGCACCTGGCGCTTGTGGCCGACGAGGCCGCGGCCCGTGCCTG
GCGCGAGCTCTTTGGATGCGTAGCCGACCCACACGTGCTGCAGCCACGCGTCGAAGGCGTCGCCGACGCTCACGTCTAAGAGCACAGACGTCGTGATCTC
CTGGCCGTCGTGCGCCGTGTATTCGTCGAACGCGGCTTGGTCGACATACCGGGGCGAGCTCA