Description :
From Genome Similarity Track
Location :
scaffold_161:11071- 22439
Transcript NameFunction/comments
g7399.t1hypothetical protein
g7400.t1hypothetical protein
g7401.t1 DEAD/DEAH box RNA helicase, putative

Sequence
11368 bases(100 bases per row)
CATACCTTTACCACTTTTCCCTCGAGGGTTGGTGCTGCTTTTTGCCTTCTTCTTCGCTGTCGTCGATGCCACAGGCTTTGCCTTCCTTTTCGCCGCCCTC
GATTCCGTCTCCTTCTCAACACTGTCGACATCCATCTCCTCCACTTCCTCGTCGTCATCATCATCTACTTCGTCGGGATTAAAGTCGCTGTCGTCGTCCT
TGGTAGTTCTCGTGACAGCCAGTTTCTTTCCAGAGCCAGCGGACGTCTTCGCGGCAACAGCTCGGCGCTGCTCGGAGACTAGACGCTTCTGGGCCCTAAG
GTAAGAAACGTCCTTACCCGTCGGAGGTCTTGCCGGAGGTTTCCAGGTCTTGCGGGGGGCAGTGCGCGGCTCTTCAGCCGCTGATGGCGCCTGGTTGTCG
TCCCTGAAGTCAACGTCGGTGTCGCGCTCTCCGGCCAAATAGGCAGCATGTTCCTTCACAAGATGCTGCCGCTCCTCTGGGTTACGACCACCCAGACGTT
CCAGAACGCGCTGGTGCTGAGCTCGGGATTCTCGCCGGGCCTTATTCCTCGCCATGCGTCTCCTGCTTTCTTGCGTTCTTTTTATTTTTCTTCAAATGAA
CACCAGCCATCTACCGATGCCAGTTTCGTTTATGAACGGTTTATGCCTACCCCTGTGCATTTGCGGGAAAGTCTCGGCTTTGTCAGCATTTGATTAAATT
TGAGTTCACTATACTTAGCCGTTTTCCGAGCCAACCCCTATTCAAACATGTTGTACGTACAACATGATTCATGTTGTCAAATACAACGTGTGGGCGTAGG
GGGGTTAACCCTTTCATGAGCCACCTACCTTAACTATACTATACAAAGTTAAGATACTGGTTTGTAGAAGGAGGCAAAATGCCTCCTTTTGAGGTGGTGA
TGGGCTCTCCAGCTAAGTACGCAGTCAGACAACACGACACCTGTAGTTACATTTTGCGGTAGGGCTCTTGTAAAAGGAGGCATTTTGCCTCCTTTTACGA
AGACACGGTACTGCGTCGGCATGTACCTGATTGGGCAGATTCGACTCCTCTTCAGTGATTGGTCCAAACGATCCAATGAAACACCACAAAAACCACGGCC
CCCCAACGTAAATTTCCCATCGCATATGGTATCCTTGCATAGACGTGCATCTGCCGGGAGCAATTATGTGGAGCATTTGTCTTTATTAAACTATACCGAC
CACTCTGACGGCTGTGCAACCGCTCATTTCCTGATTTTTTTCTCCCTGTACGAAATGGCGCGAAAGCACGCGCGCGGAGAAGAGATGCCAGCCGAGCCAA
AGCGGCGGCGACCGCGGTGTGATGCAGCGTCCCAGGACAATGACACGGCACGTTTAACGAGGGTGCTCGACTTCAACGGCGTGTGGAAGGAGCTGAAGGC
TGCTGGATGGACGCATAAACTGCCACGCGGTCTTGACAACCGGTATCGGTACGTGCTACCTGGTCGCTCTGCCAATGGAAAGGATGGCGAGGACTTCCTG
CTAGGCGAGGAGGCTGTACTTCGGTACTTCATTCAACACAGTGCTTCAAGTGGCGGTGATGGCGGCGCGGCGACGGCCACGGCGGGACGGCAGCAAGCAG
TCGGTGGCGCGCGTGGACTTGGCGATGGTGACGGCGGATGCGGTGGGACCGGCGACGATGGCGGTGATCGTGGACCTGGTGACAATGGTGTCTGCCGCAT
GGCAGCAAGCCATTATTCACGTGAGCCTGGCAACGATGGTGTTGTCGCGGCATCAACCGGATGGCAGCAAGCAGTTGTTGACGCGCAAGGGCTTTGCGAC
GATGGTGGCGGCGTTGTGGCAGCGGGACCTGTCGGTAGTGCCCGCGGTAGTGTTCGAGTTCGTGGGTGTGGGCGTCGGCGCGGTAGTGGTCTTGGCCGCG
GACGCGGAAGCGGTCGCGGAGATCGAATTGTCAGGAGCGTGATGGAAGAGGCGGCTACCGCAGCTACCGGGGCGGAGACTTCAAGACGGCAAGCGAGCTT
GGTGATTGAACCCAACCTAGAAACCCCAACGAGTGTCCCCACGCGCAGTACGCCGCAGAGACGTACTCCTCCTGCCCCTTTGATGGAGCATCTATTCCTA
AAGAAGCTGGTGGCATTTTCACCGTCAAAGGAATTGTGGATGAAGGAAAATATGTATAGATGCGTGGGCACAGCCTTTATTGTCGGCCGTGTGTGTCGTC
AGGTCAAAAAGACGAAGAAGGGAGGGGTACTACAAGTAATTTGGCTAGATACGCAGTTCCAGAATGCAGTTGAAACTCTGAGTGTGGCAGTAATTCAGCG
CGGGATCGAGAACTACCAGGCTCTCGCGCGCTCACCCAACAAGCCGGCGTGGCGTGAATTGACTGATACAGTGGTGGAAGGGGAGCTGCAGATGGAGGAA
CCGCTCGATGAACTTGAAGTCGCGTCAGACGACGACGGTATGGAAATGTACGATCCAGAGCGATTTTTGCCCGTGAGCCTTGCGGAGGTGGAAGCGGTGA
ACAGTATGCGGTTTCAGCCAGATGTGGATATGGATGGCCCCACGGATCTGTATGAACACACGGACGAGAGCACTAGTACACGCTTACTACCCGAGTACAG
TCACCTGTTTGCACACTCAGCCTCTTCGAGCTTCTTCGCTTACATTCCAATTTACTTCTGGAAACAAGTGGTTCTCGAGACGAATCGATATGCAGCCCTC
AAGAATGTTCGAGTCACCACGCCGTTTACAATGGAAGAGCTGATGATCTTCCTCGGCATCATGCTTTATCTGACCCTCACTGACAAGGGGGAGTACTCTA
ACTACTGGGGGTCACAGACTGAAGATGCGATTTTTGGTGGTGCATCTACCAGCTTGGACAATGTGATGAGTCTAAATAGATTCAAGTTGCTTCGCCGCTG
TTTGAGCTTTCGCGCTGATCCGGGATCGGCTGTGGAACGAGACCCAGCAGCCCGAATTAGGCCCCTATTGAATTTGCTCAAATGCACTGGTGGTCGCTAT
GTTGAGCCTGGCCGTACTTGGCTCTTGACGAAGCGAGTATCGCATGCCGGTCCCGCCATGGACGACATCTTATCGTGTTCAATCCCCAAAACCCTGGCGG
CAAGTATCATTTTCGTATGTACGTGCTGTGCTGCTCGATCACGTGGATCGCTTTGAACTATCGCCTCCACTGCAATAATAGTGATATCGCGGACCGCCTG
CAAAACGTGGTGAGCCTAGAAGAGGTGCAGCAGCTTCGTGAGGAGCTCGAGGATGTCAAACAAGTGCGTAAGCATGTTCTAGAGGTCGTGAGGCCCTACT
TTTACTCTCGACGAATCATCAATATGGACAACTATTACACAAGCGTCCAGTTGCTGTTGGATTTGCGTTTGAAGGGGTTGTATGGGCGGGGAACTGTTCG
GGGAAGGAGTAAGCACTATCCGAAGCACACTATTCTCCAGAAGGAGCACTCAACAAGGGGTGACTATCAGCAGTCTGTCTCCCTGGAGCACAACTTGCTC
GGTGCGTCGTGGTGCGATGGCAATACCGTGATGATGGTTACCAATGCTGATGCATCTACTGCCGCGACAGTCACGCGGCGGGTTGGTAAAAATACTCATG
AGTTTCCTGCTCCGAGCTGTATCCTGCAATACAATCGACGCATGCAAGGTGTTGATCGTTTGGATCAGATACGAGCTAGATTTTCACTAGCTGATGGTCA
TTCGTTCAAAAAATGGCATAAAAATTGGCTTTGGCAATAGTGGATATTGCACGGTCCAACGCGTACCTGACTCGACGGATGGCAATCGACACTTCCAGAG
ATCGAGATCCCCACAGGACGTTTGTCACTGAATTAGTATCTGAGCTAATTTCTGGCAGGTGGCAAGAAGCCCCGAGCGATGGTCAAATGGCGTTTGGAAG
CGGTGTTGCTGATGAAATCGCAGCAGTGGATGCAACTGGTATAACTCCTAAAGTGTACACTTCGCCAAACCCGCACAGCGCCCTGAAGCGATGTCAGTCT
ATGCCTTCGAAACAAATGTTCAAGGACAGTGGGCGGAAACGTCGGCAGTGCATTGTGTGTCGCTACGAGGGCAGATATCCTACAGAGGTGACGGATTATT
GCCTCACGCACACTGTTTGTCTTTGTAGCACTGTGCATGGATACATCGAGAGTCCGTACACGTGCCCACAGAGCACTTGGACTTGTTGGGATAAGTTTCA
CAGATTCTATCTCCCAAATGGACTCTTCAGTGACAATGGAAATGTCAACAGGTCATCGCATCTGGCTAAGTTGAAGGCAAGTAGCGCCGCGAGACCCGTC
GATAAAGCTCTCCCTATCCCCGAAAGCGATAGTGTCGTGCTCTCTTATGAGACCCAGAGCGACAGTTCTGTACTCTCCGTCGACGAAACCGACCTACTTT
TCAGTAGTGATTGTGCAGAGTTGCTCAGCGAAGATTCAGCGAGTCAAGACAGCAGAGTTGCGCGACAGATATTCCAATGATTCGCATTCTGTAGGCAAAG
AAGAGGGTATTTATCTTGATTAAAGTATGCTAATGCCTTCAGAGCAACATGACCGAATATATATCGAATAAACTATGGTCAATGTCTTTAGCATTATCAA
CAAGTGTTTCTCGTCCCAAATAACACAGTGGCAGCGTTGCACCCACGGCCATCGCCGCGGGATCTGTTCGGCCATCATCGCCAGCGTCAGCTCCAACTGC
AGCCCAGTGCCCGCGACGTTCCTGTGGTAGGCCAACTGCGCCGTTCTGGGCATCACCACGGCCTTGACAGCCGCCGCCAGCCGCGTTGTGTCCGTCGTTC
CCTCCTTCACCAAGTCCATTCGCGCTGAGACTGCGGCCGCCCAGTCCATCCCAAGCTGCAGCTGTCGTGCGCCAAGTCCTTTCGCGTCGCGCCCGCGCTG
TGGACGCCGTAAACATGTGCGCAAAGTCCAGCACACGCTGTTGCCGCCCGGCACCAAGTTCAGCGTCCCGTGGCCGACGTTCCTGATATGTTGCCGCCGT
GCACGCAGCTCGGAGTGCCGTGGCCACCATGCCCGTGTTCGCTTAGTCCTGTTGAGCTGCGCTCGCAGTCGCCAAGTCCCGTCGCCGCCCGCTGTCGTCT
AATCCAGCCGTGCCCGTGCGCGCCATATCCAAGCTGTCGTTCACAAAGTCCAGCGCGCCGTAGTCGCCGTGCCCGCTTGCACCAAGTCCAGTTGCGCCTT
GACCGCGATGTTGCTGCCGTGTACGATGCCCAGCGCGTCATGGCCGCTGTGAATGCGTGCGTCAAGTCCAGTCGCGCAAGTCCGTTGCAGGCTTTTAGCA
TTGTTTGTATATGTATATTGGAAGTGGTAGTGCCTTCCAACTGCCGCGGCCGTAAGTAGTTGCCGTCAATTTCCATCTCGCGCAAAAGCTGTTGCGGCAT
GATTCACGGTGGCGGGGGCAATACTTAGACGTGGATACTATCAGTCGGGCTCTTGGCATGCGAGTAAGCTCTTGTTGCACCACGAGCTTGGCGGCTTCAT
CAAACAGGAAATCATTAAGGAAAATGATGGTTGCATCGTGAAATGGTGCGGACGACCACAGCGGCGTATCGCGTACGTCCCCAGACTTCAGACTTACCTT
GTGCAGAAGCACTAGTCGCGACGCACATGATCGCACGCACTCATACCCCCTGCGAGCAATATCCACCCTTTTCTCGATCCCCAAACACTGTCTAGCTTTT
GTCTGCAACGCGAACTGTGCAGCAACATTTCCCAAACCAGCGCCTATGTCTAGAAAGACATCATCTGGCTTCACCGCTCCAATACTTCGAATGATACCCG
ACACCGCAGCAAGAATCATCTCCCCGGCATTTCCGTCAGTTTTACCTGCCTCCTGGCGCACATCAGCAGCCGAAACAGCTCCAAAAATCTCACGGATGGC
TCTTTCAGCCTGGCTTGGGGACAGGAGGCAAAACTTGTTCACATATTGAGGCGTTGGCGAACATGTGGAAAAAAAACAGGTAGGGAAACGCCCGAGGTCG
TTACTGTAGGTACGCTTTAGAGCGCGCAATCTCATCTTGAGTTGTGCTGCCGGACGCTTCCTGCGCATCTTGAGCTCGATGTCCTGCCAGGCAACGCGCT
TGCCGTGGGACTCATACTCGAGGGCACGAACAACGAGCTTCTTGTCTTCTGCGTCGGAAAAACTTGTGCGCATCTGAAACTGACGATAAATGAAGGAGTG
AAGGCGAGCATCTCACCTCAGTATTGTATGAGATAGGTTTGGACGCCCGAACTGGTGGCGCAGCATCACGCGGGTCCAGGATAGAATTTGGGATGGGTCC
ACCTCGTTTCCACCACCTGTACCCACCATTTCCTCATTGCGTTTCATGTGAATGACCGCAAAACCACAAAAATCACGGGATATGGGGTGAAAACAGGGCG
CTTTCGTGCAAAATTAGCATTTAAATTTTGATAGTCGGCCTCAAATCCTCGAGTGGGAGCACCTAACCCACCCGCATCTAAAGATCTGATTGGCTTACAC
AAAACACGGTCTACTGAAACCCTGGTAAAAGCTAAAAGGAAGCAAAATGCTTCCTTTTAGGGGGTCCATTTTCACCTACTTTTGTGAAAGTGCTTAAAGG
AAGCAAAATGCCTCCTTTTACCACGAAAGGGTTAAGAAATTGGTAGCAAACGCGACAACTTAGAAAGGTTGCGGACTACCCAAGTCATCAGCAGGTATCT
CTTTGAACGAAAATGTATGTCATCTGATGCATCGTTCCATCGAGGAAATGCATTTTAGAAAACTATCTCGTTCCGCAGTAAGTGAAAAATGGTTTGGCGC
CTTGGGTGCTGCTTCTATTGTGCGCGTTTCAATCAAGCCGAGTATTTCATCGATGGGTGATACAATATACCGCTAAATAATAGTACCTCCAGCCATCAAA
ACAGGTGGAGAGACTTCGGTACAAATAGGTCGTGAGGTCAACAAAGATAGCATCCAGTGCACAGACATCATTGTTCAGTGTCTCAGCAGGCGATCCCCAG
TTGCCGACTCAACTACAGTGCCAACTACATGTAGAAGTACTGCACATCAGACCAAGACCTCGTGAGCTATTCAGCAATGTCCGCCCAAGAGAAGAGAGGC
TCGACTACATCTTGCAACATCATCTACTCACTAGTACCAGCCCAGCCGCTTCCAGTCGTTGACCTATCCAAGACGTTTCGAGGCCGGCTTATTCCTGGCA
GCGTTCACACATACATCCGTCGCCGATACTACCAGTACTACCGAGAAATCTTGTTTTGCGCAGCAGTATCCTACTGCATCAACGCCATTGTGCCCATGGT
CAAGGCTCCAGTGGGCTGCGTGATGTCGATATTGGCCGTTCTCTTATGGCTCCCTATGGGGTTGGGAAGTGTGACGACACTGAGATACGATATCGTGCGC
TTGGTGTGTCGAACGTTCGACTTCTGGTTCTTCTCCGTTGTCACAAGCGTGATTGTAGTTACGATGTCGATGTACTTTGGAGATTTGCGCTCGGTCCGGA
CGGTGATCGACTGGATAGGATATCATCACGTCATTTGTGTTGATGCTCATGTTCTGGGCCTCCGCAGTCTCACTTGCTTTCTGATCGCGGCGATTTTTTC
GGTGTTCGTTGCACTTGCTTGGATAATGCTTGGGCACGTGGATAGTGGCTCAATCTTTTCAATTCTCAAATATCAAACCAGACATGGCAATTTTGAGCTC
TCGGGGCTGGATGTGATCGGAAACGGACTGGTATCACTTGGATTTCTGCTTGCAAAAATTGTGCTTCGGAGACGCAAAGTTTTGCGTTCTCATCCCAAAA
GACCAGCTATCGTTGAATGTGTCATTTATCGCGCCATACTAAAGCTGCAACCAGTGCAAGCACCGCAGAATCTTCCGCGTGGGAAACGAATGATTCCATG
TTCAAAGCAAAGATGTCATCCTTGAGAGACACTGATATCGTGCAACATTTAATGTTTGTCAACTTTTCTCAGACCTTCGCCGCGAGTAACACGCTGCTTC
CTTGGCTAACGGCAAACAAACGTCGCTTTTCGCTGTGGTCAATGGTTGTGTTGTATTCAGTTGGAGCAGCTGGACTGATACTTTCTCACGTCGCCCTTGC
ACACGAGTTTAATGAATCACATGATGATCCTACAGCACACGAAGATTTTATATTGATGGTATCATCAAGCGCACTGCTGTGCACAGGCGTGTTCACATCT
CTATTTGCTGGATTTTACCAGCCCCAACTACTCAAGTTGCTCTTTACTTCGTTTGACTTCGTGTTTTACTCCTTTCAAGTCACGTCTGCAAGTATCTCTG
TGAGCGTCTTGTACAGCTGGGACGTCGCGCACAGCTGGATGGTGATTTCGTGGTGGCTTTGGGCACACTGGGTATTCACCTTAGACGCGTTAACTCCAGT
CATGCGGGAAATGCTTCGATTTCGTAGTTGGTTTGCCGCAACCATATTATGCTTATTGCTCGCTGACCACATCGCAATCATATGCCGGATCTTCTTCGCA
GGAGATTTACGACTCCAAGACTCGGTCATCTTTGAGGGCACTATTTGGGGTCAGCAACTAAGCTTTCGTGTGATACCTTTTTACGTCAGTCGATCGTTCA
CATTGATGTTGTGGTTCTCTCGCTTAGTATACCGGCTTGGCTCAGCATCAAACGACGATGTCACTATTCTTCGTGGAACTGTCTGCTACGACAACGTTTT
CGCGAAGGGAAGACGAAAATTTTCGCAGATTGCTCATATTGTCGAAGCCAAGACATCAGCAGCAGCTTTCTCTCGACGAGCTAGAGTATCGCCTGCTATG
TCGTTCCACCAAGATCCAAGCCTAATGTGACACCCAACATATTTCTGCATGTAGGATGTCCAGTTAATCACTTCGATCTGTCATCAAATTGCCAATACGG
CGATCCGGATACTACAAAGCGACTGCATAACCAGGTGACACCTTATCATGCACGATAGTCCGCAAAATCTCAGATGTGTCCGAGTTGATACCACCACTTG
ATCAATCCACCAAGGTCGGTTTCAACATAACGGTGCATGTGAGGGGTTCAAAAGTATCAGGTTGCTCATCACTCTCCCTCGACCATTCTCTCTGCCCTCA
TAATATCCGCTAGCACTGTCAAATCGGCAAACCCATCAACGAAGTGCACGTGAACAGGAATATTTAGGTTGAGCCTTGGTTTGTTGCCCTGCAAGAGAGT
TCTCATTGCTGTTATTTGTGCGAAATAGTGCACGCATGCTCTACTGTGTTTCTCTTGGTGGTGCAAACAAACAAAAAATTGGAGGATATCTTCAGTTTAC
CGTCGCGTGCGGCACTCTTCTTCGGCACACCACTGCTCGTCCTTGATTAACATATTGAGGTGCCTGTACCATCCACGCCTCGCAGCATTCCGATCCAGTG
TCCCTCGTACATTTCATCCCCTTCGTGACCCAATGGCACCGCACAATGCTTCTCGAATAAGTATCTCCATCCTTTGTAATCCATGTCTGCGACCGCAGTC
AGTAGAGCCAAGTCCTCGCGAGCAAGTTCGAATGTATCTGGCCCATCATAAAACTCGAAGCGTTCTTCGACAGTTGCCCGGACTGGCACAAGTGCTTGGA
GGTAACGTCTCGGGTAATCACACATCGGGCGGGTTTGTGTTTGAGTGCGGTACACCACGGCACCATGAAGCCCCACCTCTAATCTAGATCAGTATCAAGA
GCAGCACTACTGCGTGTCATCGTTGGGTTATGCAGGGCGCGATAGTTGACTTGAAGCAAATTCTCAGCAGCGAGGTCGGCGGTTTGGTTACATTTTTATT
GGAGCAACCGTTCTGGTAGCGAGGAAGCCCGTGGTGTTCATGCCCTTCTCCATGTATTTAAGTACTTCTGTCGAATTGCGGGTTTGTGCCCGCGTTTGAT
TATGGCGTCAAAAGCAGTGCTATAACGATGCTTGTTCCGAGCAAAGGCGATAGCGCTCAGGAGGGCCCCTCCTGAGCCCTCTGGACAATAGCACAAAGGC
GTGATAAACCACGAGAGCGAGTTAATCATGAGACCGAATCACATCCAGTGGCAAAACAGGAATCGTGGTCGAGGTTATCAACGCTAACCGCTCTGAATAA
TCAATAGCCAGTCGCACCGGATACTCGAAATGAATTTGCTGACACTAGTTTAACGAATAAATCATGGCCTTGTACGCCGCCGTTTACTCTTCTGACTGTC
CCAGTTCTTCCATTCTGATGCGTGCGTACCCATTTCCTTAACCAATTGCTTCCGAATTCGGAAAGCCCGTTTAGATTCATCGATCACGACTTCGATGGAG
CGAGCGCGCAACTTGGCATTCTCAGTGTGAATACTCTGGTACACTTCGTGAGGCACCGATACTTTAGCTTGCCGCAACAGCGATACAAGGTCCCAAAAAA
CTGATTGGTCATCCTTATTCACAAGCGTCAAAACATTTCCGGTCGAATCATCTCCACGCCCGATACGCCCAACGAGGTGAACGTAGTCTGACACTTTCTT
GGGAAAATCATAGATCACAACATTCTGAACGTGCAGCAGATCCATTCCACGGCTCAGCACGTTTGTAGACACGAGGACAGGGGTCTCTAGATTAATAAAG
GCCTCCAGCAGATGAAGTCTTTCGCTTTGAGTTTTATCTGCATGAATCGCTGCTGCACCAATTTGACAGCGTTTTTCAATGGCTTCAGCCAGCATGCTCG
CGCCAAGTTTCGATCCGACAAAGACAATCTACAACGCCAGCAACACAAAAAGTATCAGCCACCCGTCAATGATGTCAGCTAGCTTGAAATTCCATAAGAG
TCAATGCAATCACCTCACCCACCGTTGACTCTTCGTATTTCCCTTTCAAGAACTCAAACAACTCACTCTTTTTCACCTTGTCGTCCGACCATCGAACCTG
TTGTTTAACACGAGGGTTGAGTGCGAAACTCGGTGTCCCAGTTGTCTTCGAATCACTGCGACGAACGTCGACGCGAATATAATTTTGCTGGCTTTGAACT
TGCAAGATTTGCCGCACCATTTCTTCTACCTCGCCAGCGACGGTGGCGCTGAAAAACAGCATCTGGACGCTCTTTTTCCCAGCTAATGCTACCAATAAAG
CCACGATTTGAGAAATCTGTGGACGAAAGCCAGCGTCCAGCATAATGTCCACTTCATCAACAATACACATGCGAATAGCTGCCAGGATAGCATCACCGCC
ACTGTAGTTCATGAAAATATCGAGGAAGCGCCCCGGTGTCGCCACAATAAGCTGAACTCCACCTTGTAGTCGATAGCGCTGGGTGGGGACAGGGAATCCC
CCCACCAATAGCGCCGTCTTCATGTCAGCTATGCCTCTCACCAGCAGCTTTGCCACCGTCTCAATCTG