Description :
From Genome Similarity Track
Location :
Scaffold_45:110676- 112671
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_09137hect E3 ubiquitin ligase
Sappa_CBS223.65SPRG_09138conserved unknown protein

Sequence
1995 bases(100 bases per row)
GGACAAGTCTATGCGTGGGGCCAAGGTGCGCTGTTTGTTTGGAGAAGGAGACTCAACGGCGGCAGACGCTGTCGAGAGCCTCGGGAGCCACGTCGCATTG
GACCCGACTCAGAACATCCCGCGCAAGCTACCAGGATTTCCGAATCCAGTCGCCAAGGTGACTTGCGGAGGGCAGCACGTTCTTGGCCTCGACGCGGCAG
GGGTGGCCTACAGCTGGGGCAGCAACGCCCACGGCCAACTCGGGCTGGGCCATCTCGACGACCGCAACACGCCGACGCGAATCGGCGTCGTAGGGGTATC
CCTCTCGGTCACCGCTAGTCGTTGATCATGCACGGTAGAGCCCTATGATCATCGACATCGCTGCAGGCGACAACCACAGCTTGCTCTTGACCAATGCCGG
TACGGTTCTAGCGTGCGGCAACAACTGGTCGGGTCAGCTCGGCACCGGCGGCAGCGCGCACCTCGATGTCATGACGCCGATTGCGTTCGAGGCCAACGAC
CCGATGTACCTGATTCAGGCTGTCGGCGAGACGTCGGCCGCCGTGTCGGTGGCAGGTAGGAAATGATTTGGCCATTCTGCCGTCGATGCCGTTCCATGCA
GGGGTTGTCTGTGTCTGGGGGCTCTGTGCAGTGCCGCTTCTCGGTGTCGTCACGCGGCGGACGCCCCAGCAACTTCATTACGCGGCAATGGACGCACACA
AGCCGAGCCGGGGCTTTGGCCGCCTCGACGCTGCCGACACGCTGCACGTTGTCACCTCGATCGCGCTCGCCGCCGGCTGCGTCGTCCTCGCAGTCGCCCC
CGTCCCGTATGCAAAGCTGCCCAAGACGTAGGGAATAGTAGATCATGTATGTTACCACTTTCGAAAGGTTGCAATCGCGCGTCCGAGGTCGCGCCGATCG
TGCATCGCGAGGCGGAAGCGATACCAGCTCATGTACATGGCTGAGCCACCGACGCCAATGTCCAGCTTGGTGGCTCGACAAGGCTCTGCTCGAGGACTGC
GATCGTCGAGAGCACAATTACCTCGAGCTTGGCGTCCGTACGCGCGTCGACAACGTAGACGTGCGTGGCGGACACCACGAGGCGCACTTGCACATTCGGG
ACACCAGCGTCCGACGGCAAGAGCCACTCGGCGCTGCTGCATTTTGCGTCAACGACCTCGTGCGCGGCCAAGTAGAGCGCATGCGCAAAGACGATCGGGC
CCGTCACGGATCCAATGAGTTTCCAGCGCACAAAGCGCGCTTCGTGCCGTCGGAGCGGTAGCATCGTCGACGCCACCGCGTCATTATGACCGCCGACACC
CATTTCGACGAGGAGACCGTCGGTCGTCTTGGAGACGAGCGACGCCATGCCGCTCATGGGCTGCGCGACGATGCCAACGAGCCCTTTTCCGACGCCAACG
ACGCCAGCGCCGAGGCCCGTGGACCGGCCTTGCTCTTGGTTGTCGCGCAGCACGCTCAACGGTGTCGTCACGACACCAGTCGCAGCACCGACGATCGCTT
GTCCGAACGAGTGGAAGCCGTGGGCCAGCCCCGATGTAAAGTTGGCGGGCGGCGTCGTCGTCGAAGCCGTGGCCGCACTCGTGCTGATGTGGTCCATGGA
CCGCGAGATGGCATGGGCGACACCCGAGACGGACGAGAGCGTCGCGACCTACTTGTGTCATGAGTCCTGTGACGTACTACAGACGATCGAGACCGAAGTA
TGCGTCGCGAAAGACACGGCGCCTCGGAAGAGGCCTTTTGTGATCGAGACGGGCGAGTAGCCTTCCGTTGCGACGGCGAGCAGCGGCAGTCGCACGAGGT
CCTGGACCCCCGAGCTCACGTCGCGCACAAAACCTCTATCGTTGTGTCGCGACAGAATAGGATACAAGGCGGCGTACGCAGGGTTTCCGAGGACGTTGAG
GGACATGAGCACCATCGGACTGCGCACAACGGCGTCGGCGACGTAGTTGGCGGCGAGGTCTTTCGCGAGTTGGTCGTCGAAGCATAGAACGTTGG