Description :
From Genome Similarity Track
Location :
Scaffold_1013:11061- 12669
Transcript NameFunction/comments
Phypl_g12057hypothetical protein

Sequence
1608 bases(100 bases per row)
GAAAATGATGATGATGAGTTTCTGCTTGGAGATGATgtgctgaagctgcttggGATTGATGTCAAAAGGCAATTGGAGCTTCTGGCGTCACCAAGTGGag
acgatggagatggcgacgacgaagggcCGGTTGTGTCCTCGCGCAACAGCGAGAGTGATGACATTCGCAAGGCCGTAGAGTCGATGATTGAGCGGGCCTT
GGCAGAAGGTTTTCAGGCTGACGAGGTCGATAGGCTGCGTACTATCGTATATGCGTACGACGTTTGGAGATTGGTTTTGGGTAACGATCCTCCAGCAAAA
GTAGAGCCGATGAAGGTAAGGATGAGGACTGACTGCAGGCCGTACAAAACGAGGACTCGCAAGTACGCGCCAGAGTATCAATCCTTCTTGGAGACCTTCA
ATGACATGTTGGTTAAGCTTGGTTGGGTATATGAAAATCCAACGAGTCGATGGGTTTGTGCTGCACTGCCACTGCGCAAACGAGATGGAAACGATTTTCG
CCAGACTGTGGACAACAAGCCATTTAACGTGCAGACTGAGCCGGTGGTAGGATTGATGCCGAACCTGCACGTCGACTTAGAGAACGTGCGAGGTAGCAAC
CACTTTGGTTTGTTTGACTTCATAAAGGGGCATTGGCAACTACACTTGCTAAAGAGTGTCAAGAACTTCTATCATACATGACGTACCGGAAAATCTACAC
CCCAAAGCGAGTACCGCAAGGAAGCGCTGATGCTGCTTTAAATTTCCAGTCTACTATGGAACGCTGTttcgccgcgctgctgtaCAAGTACTTGCTAGTG
TGGATTGATGACTTGTTGTTGTACACGGCGGATTTCAACACGTACCTGGACAagttgcagcaactgctggaACTAACGGCGAAGTTTGGCTTCAAACTGA
GTTCAGCCAAGTCCTGTCTATACAAGCGAGAGGTCCAGTGGTGTGGCAAGGTGATCAACGGTGAAGGAGTGAAGCATGATCAAGAGAGGATACAGGGGCT
GCGAAGCATGCCGTCCCCGACCAATGCTGGGGGGCTGCAGCAATTCCTCTGTCCCACAAATTGGATGAGAGACAGCATCGTAGACTATGCTCGATTGGCA
CGTCCACTGCAAGACACACTGGACTAGGCGATGGCCAAATCGTCTAGAAGAACAAAGCGCGTGGCTTCGGGAATTCCTGTGGCACTCACCACGGAAGAGC
GCGCGGGGTACGACAAAGTCAAAGAGGCTCTAGCTGATGCAGCTACCCTCGCATTCCCAAAGCCAGACGCCGAGATGATTCTGCTTACAGATGCCTCAGA
CGTTGGGCGATCCGTCATTGTTACCCAAGTGCCGAGTTGGTAAAACAGTGCAGATATacaagaccagcagcacgagctgttAATTTGTCTGGGTGTTACG
TTTACGGGTGTGCAGAGGAATCGAAACGTTATCGAAAAGGAAGCCTACCTGATCATCATGGCGTGTGACAAATTGAGTTACCTGTTGTAACGACCTCGTC
GGTTTCGCATGTACTGCGACCATCGCAACTTGATACATGTTTTCGCGCCGGGCCGTGAAGTAAAAAAGCACGTGCGTGGAAAACTGCTTCGTTGGGCTAT
GAAGTTGA