Description :
From Genome Similarity Track
Location :
Scaffold_39:11061- 12449
Transcript NameFunction/comments
Sapdi_VS20SDRG_11073hypothetical protein

Sequence
1388 bases(100 bases per row)
TTTCGCAGCCGTTGAACTTGCAGCGCGCGCCGCCGCCGTGCGCCTTGCAGAGACCTTGGGACTGCGCGGCGTTGGAGCAGCCGTCGATCTTGCAGCACTT
GCCACCGCCGTGGCCGATGCAGTAGTTGCCGTTCTGGGCTTCCTTGACGCAGCCGTGCATGCAGCACTGCTTGCCGCCGCCGTGGCGCTTGCAAAAGCCC
TTGGAGCGCACGTTGCGGTGGCAGCCTTCGGTCGCGCACGTCTTGCGTCGTGCGGGCTGCGGGAGGTCAATCTCAAAGTCGAACGAGTCGCGGTCCGTGC
AGTTGCTAAAGTCGCTTGACGACGCGCTGCTCGAGCGGAAGAGCGGGAGCGGATCGGCGTACGACGAGTGCGCGAGGTGAAGCGGCGCGAGCGGATGGTC
CAATGGCAACACCATCATCGAGTGGTGGTCCATCGAGAAGGCGCTGGGAAAGTGGTCGTGGTCGAAGAGCGAGATGAGTTCGTGCTCGTTGAAGAGCGGC
GCGGGGTGGAAACCGCCAAACGGGATCGGGTCCAAGTAGCTCGGGATCGGGAACATTGGACAATGTGTGTGTGTTGAGAGGAATTGGGAAATGAACAGCA
GACAAAAGCTTGAAACGACGACGACGACGACGGAGGGAAGAAATCGTATGGCTGTCCATTGACTGCCACCAGTTTGTACCAGAGAGAGGGGCAGCCATTT
CACTACCTTATATAGCGCCTGATGCCCAGCCACATGGGGTGATCCAAGCAACTGGTTTGGTCCATGAATTTTGGCTCGGCACAGCCTCCCCGCGAGATTC
GCAATTTTCCGTAGAGTGGGATGTTGTCTGCAGTGCAAGAAGAAGTACTATGCTTCACCGACCGCATGTTGTCCCACGAGACAAATGTGGTTTCTACACA
CTGTGGTCATGCCCAACATTGGCGCGTTTGGGCCGCACACTTGCTCTGGATCCTTATAATAACGCCAAAGCGTTGAACTGAAAAAGTGTATATATCTTTG
CAGCTGATCTTAGTACAGTGTAGAGGCTGTCCGTTTCGAGTGGTCAGCGTGCAGCCGTGCATTTTGGACCATGTCATCACGCCGCCGAGCCCCATTTCGT
ACAGAAGCCGTTCGACGAAGCGAAAGGCGAGAAAAGGGTGCTGCTTCGACCGGGTAGCCAGCCACTCGAGAGTGTTTTGAGGCGGCCGTGACAACCTCGA
CACCACAACGCCGAGTAGAAAATATACGCCCGACTGCGATGAGACGGCAGTTGACGCTGGCCGCGTCATGGACGTGTTGAATAGTTCACAACCAGAGACA
AAACTTGTGACCACACATCACGTGTGAGAGAAAACAAGCCATCAGACATGTTCGCAGTTTGTTGACTCTCAATTTTCAACATGATCAC