Description :
From Genome Similarity Track
Location :
Scaffold_85:110602- 113303
Sequence
2701 bases(100 bases per row)
GTACCGCTTAAGACGTCCAGCATAGAACATCGGGTGCGTCGTCATTGACGTTGGCAGGTCGATAGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAC
GGTCCGATGAAGCGGTACTTCAGCTTGCTGCTGCCGACAGAGCTGACAGTGTCAAGAGGTAGGATCCTCGTGTCTAGCAACACTAAGTCCCCAACCTCAA
ATATACTTAAGTTTCCTCTTCCATGTTTGTCTGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGCTCAGCTT
GGTATCCATAAAGGATTCCACCTGTTTCCGCAGCAAAACTGGTCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATG
GAGGGGTCCGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTTAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGT
TGAGCGCAAACTCAACAACTGAAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTC
TGTTCGGCCGTCTGTCTGTGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAAGCACGGG
TCTCGGTCCGAGACAATCGTCTCCGGTAGACCGTGATAGCGGAATACGCCATCGACGAACAACCTTGCGGTTTGTTCGCACGTAACAGTAACGGGAACTG
GAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGCGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCAT
CGACTTCCAACAGTCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCATGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTGACGTAC
CGGGCCACTCACTTGTACATGTGGGTCCACCAAAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGGGAGCGCGTCATGCG
CCTCCGCTAGGATGTCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAA
CTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCTGCCATAAGGAACTTGACGATAGGCGCGACAGCCTCA
TTGTCCCGATACGCCATGCGTATTCGATCATATAGATCCCTTGTCATCCGTGTGATGTGGGCCAACTCGTAGTCAGGACGCCGAGGGCGTCCGCAAGCAC
GTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGCTATATTCCGTGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCC
GTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCCTAGAGTCCAGAAGGTGAACACGGAACTTCACAAGGACATATTTCATTGCCAGGAGCTCCT
TGTCGTGGACAGGGTAGTTCCGCTCGGTGGCTTTGAGCTGCCTGGACTGGAACGAGATGACTCGTTCGTGTCCGGCCGTGTCGGCCTGCAGCAGTGCACA
CCCGATGGCGTAATTGGACGCATCGCAGACGACGCTAAACGGCTTCGTCTAGTCCGGCAGGGCCAGGACAGGGGCCTCTTGGCGACTGGCCTTGATGCTG
TCAAAGGCATTTCAATGCTCTTGCTCCCAGTGCCAGTCGACGTCCTTCTGAAGGAGGCCTGACAAGGGCTTAGTGAAGCCCGCGTACCCTGCACTATACT
TGTGAAGGTAATTGGCCAAGCCCAGCCAGTTTCGAAGATCCTTCTGAGATCGGGGTGTCGGCCATGCTGCTATGGCCATGACCTTGTCTGGGTCGGCCCG
AACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATTACG
TCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGATATGGACGAATATGCCGTCGAAGTACGTCTGTACGA
AGGTACGCAAAGAGCGGAACAATTGCGTCACCAGGCGATTGAACGTCACCGGGGCGTTAGACAAGCCCTGTGGCATGACGAGCCACTCCCAAAGTATGCC
GCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGCTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCTGCGCACTGTGCAGTACGCTCCCG
GCGATGTTGTTTAAGAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTC
CGTTCGGCTTCCGAACGCAGAAAGTCGGCGTAGAGGGTGTCGATTTCGATTCCCGCACCATGCATGCCTTCGCTTTTGCGGCGAAGAAGGCATCAATGAC
CTCGCACTGTTCGCGCGGGAGTGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGT
T