Description :
From Genome Similarity Track
Location :
Scaffold_245:11059- 12352
Sequence
1293 bases(100 bases per row)
TCACCGGAAGAAGTCCCGTACTAGTGATAAGGTCTAAGGCGACCGACGTAGAACGTAGGATGCGTGCGCATCTTACGTGGCAGTTCAATCGTGTATGCGT
TGCCTATGCGGCGCAGCACACGAAATGGACCGATGAACTTGGGTAGTAACAAGTTACTACCCACGTTAGTCACAATGTGTCAAGGTAGGTTTACCGTAGA
TAGTAGGAATAGGTCACCTATATTGAATGAAGGAAAATTTGCCCTTCCATTCTTGTCAGCGTTTTTGTTTTGTCGGTCCACTGTTTCTGCAATGGAATCT
TGCACGAAACGGACAACCGTTTCACGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTGGCTATAGTGCGCTTGGAGCGCACTGCGGCAAGATCAG
TGACCTGGTTAGTAAGAGCACCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGCGTCCGCTCGGATGATTTCCCCCGCCCC
AAACTAGAGTTACACTCGGAGAAGGTGGGTAGGCGTGGGTGGCGCAGGCCATTCACGAAGAACGGTGCATGCATCGTCGATGCATGCACCGAGTTGTTGA
TGGCGAATTCCACCATGGCAAGAATTCGCTCCAATTCGTAAACGAATGGACATAAACCCGAAAGATTTCCTCAAGAACGCGGTTTGTACGTTTTGTCTGA
CCATCTGTCTCAGGATGGTCAGAGGTCGACATCTGAAGGCGCGTTCCAAGTGTTTTGAACACGGATCGCCAGAATTCCGCAGTGAATAGTGGGTCTTGGT
CGGAGAAGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTCAAAAAAAACACGAGCACATGCCGATGCATTGATAGATTCAGGTACAGCGACCAG
GTGTACCATTTTACTGAATCTATCAACGAACACAAGAATACCTGTAATCTTGTGTGGGTCTGCGGGGAATCCAACGACAAAGTCCATTGAGACGGATTCC
CAGCATTCTGCCGGAATGGTCAAGGGTTGCAACGGCGCACGAAGTAAAGGACCAGACTTCACTCGTTGACATACTTCGCATACGTGGACGTACTTACGCA
CGAACTGATACTGGCGGGGCCAGTAAAAGTCGCGACTAACCGTGGGATATGTCTTCTCTCGACCACGATGTCCACCAGTAGATGCATCGTGGTACTCATA
CATGATGCGCAGTCGCAGGTCACCATGGTCCAGTACGACGACACGAGGCTTGTCGCCGGCAACGGCTGTATACTTCAGAAATCCATTGTGGAC