Description :
From Genome Similarity Track
Location :
Scaffold_29:110549- 117215
Transcript NameFunction/comments
Albla_Nc14031990GPI ethanolamine phosphate transferase putative
Albla_Nc14032000GPI ethanolamine phosphate transferase putative
Albla_Nc14032010cysteine protease family C26 putative

Sequence
6666 bases(100 bases per row)
GATGGGAGCATTGCTCATATTCAAAATTCTGATTCCGTTTGTGGTTGTTATATGCGCATTGTACGTGATTGTGGCAACAAAAAAGGCAGCACGTTATAAC
TCAAGTGTGTCATCATCCCTCAAAACATCCGGTTCTATTTCTTCTGCTTGGAATTACTTCATTTTGGTTGTGTTGTTTTCTGATGTATTGGCATTGCACT
TTTTGTTCTTGGTGCGAAATGAAGGAAGCTGGAAAGAGATTGGCAACTCAATCTCGCATTTTGGAATCGTGAACGCGCAGATTGTGTTCTTCCCGCTGCT
GTTTTTTGTGGCCGTACGTCTGATCGTTGTGACACCAAATCATCGGAAAGGCGTCTAATTTGTATGCCAATTGATCGGATGTCGAGCATTCTCATTCCAC
ACAACTGGATGTACCAGTTAGATGAGATGATGATGAGCTAGAAACATGGGACCTCATATCTCCACGATATTGGCTTGTATCTCTCGATCTAATTCCGCCA
CAATTGTAGCTGTTCTAAGCCGGTCAATAAACTTCATAACAAATTCCGTGGACTCGATCCGGAATCCAGATAATTGAAATATATGGATGATGCTTGGTGT
TTCCGTCAGGATCTCTGGATATCGAACCATTCCGTGTTTCAATCGCATGAAAGGACACGTTTCACCTTCTAAGAGAATTCGATGCAGAATTTTGCGTATC
GATTGCAATTTTCGGCAACGCTGTATTGAATCTTCACATTCGGTCCGTAGAGAAGACAAATGATCACCAAGCTCACAAATGAGATCATGCTCGCCGGTAT
CGTCTGTACCTGACGGCATCGACTCAAGCCGCGAACTGCTCGATCGCTGAGCCACTGCCGTATCATACCCATCCGTGCTTCCTGCCGTAATTCTATTGTG
CATGGAGCCACGTGTATCGTGATGGCCACTATTGATCCAGGAAGATGAGTGGCTACTTCTTACGCTGGATGACGCCGCTGAGTTTCTGTCGTTGCCATAT
TCCGGGGAAGCATAATAAGAATGGGAATATCGAGGCGGAAACGGATGAGCTCCTCTCGAATGAACGGAGCGGAATGCTGGTCGATTCCCACTGATCGGAT
CGTGATCTGAATAATACTGCAGAGTAGACTGAGTATCAAATTGAGCGTGGTCATGGTCGTATTCCGCATCAGAATAACAATGTGATCGATTTTCTTCCAT
GACATTGCGCAACTCGCTATCCGGTAAACGAGCACCAATACGATACGAATGAAAGTCACCCATCCCGCTCTCGATACGTTGGGAGCTGCTGGGTTCTACT
GTCCAAGAGCGATGTCTTGTATGATGTCCGGTAGTAGGTCTGTTTGTCTTTCGCATATGCGACCTGTGGCGATTGGAGATGTGCACTCGGCGGGGAGCTT
GAGATATTTTATCTTGACAAAAATCTTCCAGTAAAGCTTCGTCAACCCGCTGTTGCGAATGTTCCATCTTTCTTCTACAGCAGCTGCCATTTTGGCCACC
AGAATCGTCACGGTGAGAAACACACCTAGCTCTACCTTGAACAAATGAACGTCCAGCTGAAATCGTAGCTTGTCGCAAATAGTCATCGATTACTGCAATT
GAAGCAGATCCATCATTGCCTGTACTTCGGTCGTCGTATGAGAAGTTTTCGCTTGAGCTCTTCGTGCAATCGATGGTGCTACGCAAACCTACTGTGCTTG
GGTCAAGTACACGCCAGCCAAAAACCGCTGATTGATCTCGATCTCGCTTTGACCCATACTCTCGGCTGGTAGCAATATCTTCATCAAAATTGTATTCGAG
ATTGTTCGACCGCTTTGTTTGAGACTCATTTGTAGGTGTTTCCATCGTGTAAGTTGTTGAGATTCTATCAGAAGTAAAATCCTCACTACAACACACACCA
TGGCACGAGACACACCCCAGAGTTCCATTTCCATTTGGTATGTCTGCGCTAGGGTTCCCCTGCGTCGAGATTGATTGCTCGGAAGAATCCACGACGTCAA
ATATTTCAGACACCATTTCCTTGGTGACTGGTAGCTTTCGGCGACAATGAGTGTGCGGTGCGATGATACGTTTCATTCTGTGCCGTGATAAAGAATGTTG
GCGCAGATTTTCCTGACGTTGACGTTGTTTATCCTCAAATATGTATTCACTATCGACGTTGCCATCTTCATCGATAGCCACAAAGTATTCACGCATACCA
ATGCCCGTTTCAATATTGGAGCCTGTTTGTGAGTCATTGAGGGAGCTTCGGTCAGAAGTGTACTCGGAACTATAGCCAGATGTGTATCCCGACTGATAAC
CCGCAGCGACGTCGTGACGCTGTTTTGAACAAGTAGTATCTTGATTCGGTGGATGATGAGTTCGATATTGCAAGCTTTTCTCGTTATCTAATTCCATGCC
AACGTCAATCTGTTTTAGACGCTCATGAGCGAGTAGTAGACTCCGTTGCAATCCGAAAATTTTTTCTTCGAGCTTTTCAATGTCATGCGAGTTGAGGACC
GAATTTTTCTCCAGATGAGGAGGGTCGTGGCCATCAGCCAAGGTTTTCGAGCATACACAAGTTGTATTTTTTCGCGAACTCACTTCCGATAGCTCTGCAT
GTATCTTTGCGATCGTACATTGGTCCTGGAGTTGTTTTGCACACAATGCTGTTCCTGCACTTGTTGACGTACCTTGAATAATAGAGTTGTTTGATAACTG
ATCGCGACTTCCATTCGGCTGATTGTGCCCGTCGACGACTCCAGTAGATGAGGTATTCACAGCCAAAATAGCTTCTTTTCCATCCAGACTTGTTTTGTGA
TGACCAAGCTTACGCTTCCTCCGAACTCTTGTTTTATTTTGTGACTTTGCAGACAAAACCTGTTTACTTCGTTCTTTGTCGCTGCTGAATATTTCCGAGT
TTGACATGAGCTCCGAATCGGAGCTATTCAGTTCTTCTTGCTTATAAAATACACTGCCCAGTGTGTCCATCAAATGCTTACTTCGTTCTTGGCATTCCTT
TACGATATGATGGTCAGCAAACACGGAGGATGAGTCCCCGGCGGTCTCGGAATCCGCGTCACCGTCCTGATTCAGTATCGTCTGATGCATGGCTTTTCGC
ACTTGGTCTATTTGGCTTGCAACATCATGCAGTGCTTTCTCGTCGATCAATTTTGGCGGTAAAAACGACGAGTTTTCATCGCTAATCAAGTCGTTGAGCT
CCTCGGGACGCGTTTCCAACATTTGAGGTGCAATTTGACTCGGTGATGTACCTTGTTTCATCGATTTGGAAGGGATGTGTGCTTGACCTCTTTTCTGCTC
GTCTTCCCATAGAGTGGTCATCACTTTCTTCGGAGCTTCAGAAGATGAATGGCGATTTTCATCGTGATCTTGAATTTTTTCATTTTCAGTCTTCGCAGCA
CTTTCATTACTTTTGATTCTTTCTCCACAGCGACTGGTATTTGTGTGTTGCCCATCATCCCGTACCTTTCGACTCGAGGTTCGCGCATTAATAGTATCGG
TACTTCGCCCATGACCACGTATGCTGTTCGCACTCGACGAGGAACGATGTACCGACTGGTTCAATCCCGAAAGACATAACGTGCACACTCGAATCGACGT
TATATCCGCAATTGGATGCTCCAATTCTCGAAGCGGTGCACAAAAAGAGCATACAACTTCCCCACAAGCTCGACAGTGATGCTTCCGATGCAGAAAAAAG
TTACGTAGACAAACGGCACATACTTTTCGATCCGCGTTGGGAATCCATTGCCATTGTTCAACAAATTCCAATCGACTCATTCGCTGTCTTTCCAAAAGCC
GTTCCAGTCGTGTGATATGACCAACATTCTCGATCATAATTTGCTCCACTTGTTTCATGATTGTGGGTGACGCATTTGCTTCCGTGTCCAATTGACAGAT
CACGGTGACGGAGAGTACATTTTGACGCAAAGTTTTGGTGACAACGATTCCGAAGAGCGAGATGTTCCCGCGCGCAATTCCAAATGCTTCCAAGTGAGAA
ATTTGAGGAGTGAGATCGATCGAATGTTGAAGATAAAAAGCCAGAACATTGGAGGAATGTTGGTTTCGCCTTGTCCCAGTATCCAGTTCGGAGCAAAAGT
CCGTATAGTTTCCTGCATGTTCTAAAACACAGAAATCGACTGCTGTATCGGGAATAACTGTACGAAAAGGCATCATCATTCGCTTTGCTGGGAGTGGTGG
GGCCAAATTACCCTGTCGCATATGATCTCGTGGTGTGAGGAGAGAGCGGCGCAAGTACATAAATTGATTCGTTCCCATATTTGATGTACAGGGTGTTTCG
ATATGTAAAGCATGGGAGTTGGTGGTTTGATGTGGAGTGATAGTCACACCGGATGTTTTTCCAATCGTACGACATTGCTGGTTGGATAGTTTGATATGCT
TGATGGAAGCGAGATTTCTCCTTTTATATATACGGTGCTGACCAAAAAGTTGCCATTTGATTGCGTAGTATCCTTCGAAACTGTAATTTGAAGAAGGGGT
GTGCGTTGACCTCTCTCTCCGACTTCGATGACGCCGCCCTTTCCCACTTGGTGGACCCCATGACATACTAAATTCGGTTCTAGAGCTTAGCTCTTTCGAG
TCAGCTGGTGGAAGATGAAATAATGTGCGACTGTCAATAAATGTAGAAGGATATAAGAACTGTGACGATTTCCGCATGGATGTTGTGGACAAGCGAGCAA
TTGCATCCATCACATCTTCACAAGAAGCACGAACGAGTACATTTGACTTCAAGAGAATTTGAGATTTTGTGGGTACTTGCATACAGCTACTATCACCGCG
ATTCGATAAAAGGATATCGGCTGCATGTATCTTTGGAGGTGCGAGTGAAGGGGATGGTAAAGCTTCGGAAGGGACAACCGCTGGTGTGACAATGCGAGCT
TTGAAGCATGAGTGTCCAGATTTTGATGTAATTTCTGCCCATTTATACACGCAATCCGCGTCTTCTGCGATGCGAACCAACTGGTTGACTTTATCGCGAC
TTTGTTTCTCATACGTTGCGAGTTGTGTATCGGTGAGTGTGACTGGAGGAAATACATTATCACTCAGAGGAACTTCTAGCACGGCCATCCAATTAACAAC
AACAACGTACAAATAACACAAGAAATGAAAAGCCACTGACTTTTCCACTTTCCTTGGTGAGAATGCACTGTAAAGAAGTAAGACTGCAAGAGGGACGGTT
GACGTGCTGGTACCGTGCCGAAATGTCTTCTTATTGGCAGTATGACTTTTAAGTGTGGCTCGTCTTACACGACATATAAATCCGAAAAACAATACAGAGA
AAAGACGTACGATTATATTTCATGGAGAGTGAAGTAGTAAAAAGTCAGTGCGAACGCCAAACTCGAAGACATGTACTGTTCCGTACCTATTCAAACAAAC
TAGGTACGGTATAAAAACTTAATAAAGTATTGACACCACTCATTACATACATAAAAACATTGAAAATGGATGACGACTTCCAATTCGACTCAGACACCCA
CGGAAGCTCGACATTCTGGACACGTTGGACTCTGACCAAGCCAGTGAATAATACAGTTTTCGTGGAATATGTGTGAGCATGGAAGTTTAACGGCTTCACA
GTTTTTTCTTGGTACTGTTCCACTTTCAGATGACTCAATTGTTAATAACCCATCCAAACAGATACTACAATGTTGTTTCACATATTTGGGTAATAAAACC
TCGACGTCTTCCAAACTTAATATGGCGTTCGTGTACACACAACTTGTTTCCATGATTTTATCTTGAGGGACCATCAGAAAATCACATACAATATTATACA
ACTTGTAAACCTCTTCAATGCCTGCAAATGATAAGTGAGTGGCGACAGTGATAGCTGGTAATATGATCTCTAGAGTCTCCCATAATTGCGCTAGAAATGA
CTCCAAATTACAGCGTCCACGATCCATCCGCGAAATATCATCGTGAGCTGCAAATATGTGATTCAGCATATTGTATCGATACACTATACCATACATAGAT
CTGATAAATGCGACATACGGTGCTTTCTCTTGATCAACATTCATACTCTGGTGTACTATTTCCATAATATTTGGAAGAATAAAAACATCCACTGCACTCT
TAACAAATTGCTGGTAACTCGCATCTGATATCGAGAATAACCACGTAATCCACTCTTGATTTTGAGTTTGTTGGGTTGAGGATCCTGCGCCCACAGCGAC
ATTAATAGATACACGATACACCACTGTGTTACCCACACAGAGTATACGTGCATGACCGTGATAGTCAAACGCACTTGGTAATTTTTCGTAACTCATTTTG
AGTAGTCGACGTTCTGTGGATTGTTTCTTAAATTCAGTTATTTGCATGTCGGCGTTTTGATAACAAGCTGTGTGCGTTGACTCGTTACGGATTGATGTGA
GCATGATTCAAGTGATGTGCGTTCTGAGGGGAAAGTTACAAAGTCTGAGTGGTAAATAACGAATCCCTCCGTCTTATTGAGTTTCGCATTCAAATGTACT
GGAAAGTTGAATCGACGGGAAAGCCGATTGAACTCCCACGCTTCAAAGAGAAAAATTAAGAAAGCACTAAGGCATACAAAATTCGATTCGTAACGATTGG
GTGGAATCCTCAGGTAGAAGAAACCGTATACTACTCTTTTTGAAGCCTGTCGAGAGGGTCCAGTGG