Description :
From Genome Similarity Track
Location :
Scaffold_15:110537- 112937
Transcript NameFunction/comments
g3101.t1hypothetical protein

Sequence
2400 bases(100 bases per row)
CGACAGTCGTGTACAGCACCTGCAGCAGATTTCCAACGCGAAGTACCATCTCGTCCTCGCCAAGGTGTCGCTGGGGTTTTAGTCCACTGCTGACATTGAC
GACGCGAGCATGAGGACTCTGCATGGATACCCATACGCAGTATTAGGTCGCCACTGTGGAAAGATGCAACGTGCGCAGACTTGGTCTCGCTCGACTGGTG
CTGAAGAAACTCGGCGCTCGTGATGGTGGCTAGACGAAGGGCCTTGTCCACAACGCGCAGTGCTCCATCCCGCACAATGAAGTGAAGATCACGCCTTTAG
TGAAGATCACGCCTTTAATGTAGATCACGCCTTTAATCGTCAGTAGATGGCTCAGATACTGGACCAGCGCAGATACTTTGCTGCCGTACGTTGGCATTTG
CTCATGTTCTCATCTTGGCGGACCACTTCCGAGCCAACAAGTGCCGCCCGCCCAGCTGCCTGTTTGTATAGCATTCGAAAACCAGCTTTAATGTCTCCAC
CCTCGTCGAAAAACTTGCTCAGCCCGTATCCTTCGATGTCCTCGAAGCATTGATCCACTTTGGCGTACGTATTCTACCAGATAGCCTTGCAGATTCCTGC
TGTGTTTCTGGCTGTAGCGACCAAGCGCAAAAAAAGAAGTGGATGCGATGGAGACTGCGACCTGCTGTCGGTTCAAGTGATAGCTTTCACCACGAAACAG
GTCTTACCCTTGACGCGTGCAGGTACGGGGATATCTGTAGCTCCATCCTGCTTGCCACTACGCTCGCGGTCAAGTATCCGACCAGAGATGCCGGCGTGCA
CACAACTCTGGCGAGCAGCTTTTTACTGCTCTACCCACAGCATTTCCGACAGTCGATCCCTATCGGTCGTTGCCAGCGACCCGTTGGTGCCTCCTCCTGA
ACGACAGTGTCAGCAGCGCCCTCCTTTCCTCCAGCAGCCAACAAGTCGACGCGTCATAGAGCGAACACATCATACTCGCTCTGTTTCGCAGCCAGCACAG
CAACAACTCCTTCGGGGGCAACTTGACAGGGTGTACCATTCGTCCACCTTGATCTCGTCCGTGATGGCTCGCTGCCTCACCTGCGCACAGTTGCGCAGAT
AGAGATCCCGGTTGGAGTCGGCAACGCAGGGTCGTGCGACAGCAGTCACAGGCGCCTACACCCCAATCGCTGGTTGTTCGCGCACATGGACTCACTCCGC
CCTGCTGTAATCAGCCACACAGTGTGAGCCCAGACCTAGCACCACGTCGATCTCTCTGTCCTCGACGAGCTGGTCTACCTCGAGCTTCCACTGCGTTAGC
AGATGCGATACCGGCATGGGCTCTTCGGTGGCAGGAACAGTACCTCGAACTGGACGTCCTTCTGCACGCGCGTGCCGGCCGTCGAAGACCCCACGAACAC
TCCGGTAGTGAAAATGTACTGCGCGTGGAAGAGTCCGAGAGCGTCGGCCGCGGACTTGATCATCTCCTGCTAGATCTGTGTGAGGCTGCTGCCGTTGGGC
ATCTCGATGTCCCGTATGATGCCCAGCGCGCAGTCGTAGTACTGAACGATGCTTCTTAGGACCGTGAGTCCTCGATGTAGTCCTCGTCCACCTCGCACTG
GCAGTTGTTCTCGTGCAGAAGTCCTGTGCGATCCATTTTTTTGTTTGGAGATGAGTTAGGTCAAAAGCAAGAAGTCGATGTGCATTTTTGGGCTTCTTAA
ATGATATTCCAGCTTTTCCCATTCCAATCATAATATGAAGTATTTTTTTTATATTTTGGATTGCGTTGGGAACTGTATCCGTCTGTGGAGTGAACAGCTC
AGGATATCGCAGCCTAGGAGATCATCTATCACTTGTGTCGAGCATTCGTACGACAGTTTGACGACAGTGCTATCTAGGCGATATCATTGGTCAAAAATAT
CCGGCAAGTGCGCCAAAACTGACACTGAGTGCTCAAGTAAGTGCATTTATGCTTGGCGTCCTCTCTTCCTCTGTCTAGATGCTACATTGTTGCTCTGTTC
GTGTTCTGTCTCCCTAACTAGACGAAGCATTGTGGTGATCTTGAGTTGTGTTATCCGACGAGAGCGACGAGAAGAGCTAATCGGCAGACCGTTCATCCCA
GCAATACGCAGCATCGCTGCTTGCTGTTCAGTCATAGAGGTAGGTGGTTGGGCTCCAGTCTTGCGCTCAATTGCTGCAGAAATGTGCTGCATCATAATTC
GCCACTCTGAATAGGTATGCCGCTTCCTCCTCGTAGATAGGTCACCTGTGCCTGCTCCTCCCTAGTTGCGCTCAGCTTCGATGCGCTTCAGATCGGCGAA
AAATGTTTTCATGTCATCAATGTAGGCGACAGAGTGACAATTTCTTCTGCCGGAAGATGTCTTTAATAGCACTTCGATAGCCGCTGAGGGTTGTAACCTT