Description :
From Genome Similarity Track
Location :
Scaffold_54:110535- 111718
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_09822conserved unknown protein

Sequence
1183 bases(100 bases per row)
CTTGCGCTTCTTCTCTGCGTTGACCTTCTTCCAGTCAATGTTCTTCTTCTGGAGCGCTTCCTTCATGCGCTTGGCCTCCGCGCGGTTGGCTTCAAACGCG
GTCATGTCGAAAAAGTTGCTCATTTGGCGCCCGGCCTTGTCGCTCGGGACGCCGGCCTTGGCCCAGTAGTCGTTGTCGAGACCCGCGCTCGCAAACCGCC
CGCTCACGAGGCTCATGCCGGCCGTCGACGTGTAGTCGTACCCGACGCGCGAGGCCATCGATGCGTTCGCAGCCGCGGCTTGCGCATCAACCGGGACCCA
GTCCGCGTTCTACATGCAAAGCGTGAGTGCACATCGTATGCGGACACACTACCACGTACGCCGGCCGCGATGCCGCCTTCGGTCGGGACCTCCCACTGCG
TCGTGCCCGTCGCCGCGTCGTGGTAGTAGTAGCGCTGCGTGTTGGTGTCGAAGTGCTGCTGCCAGCGCGCCGAGCTGCCTGACGCCCCCACGTTGCCAAG
GATCGAGTTGAGGCGGTTCACCGGGTCGTTGGCACTCGGCGCCGACGTCGTCGTTGTCGGTGCGGTTGCCGTCGCCGCCGACTGCGCCTTGGCCGCCGAC
GAGTTGGCAGCGGCGGTCGCCGCCTTGTTCATCCATTCTTGGTACTTGGCGCTGCCCGAGACGACTTCGGTGCTCGCGATGGCCGACCCGTCCTGGATCA
CACCATCGACGGGCTCTTCCCACGTCGTTTCCTTGGTGCGCACGTTGAAGTAGTACGGCTTGTTGGTCGTCGCGTCCATGTACCGGTAGTAGTCGGGCGC
CTTCTCATCGGCAAGAGGCGTCGGCTTGGGCGCGTCTGCGATCGCGCCAAAGGCGTACTCTTCCTCGATGTTTTCGTCCACTTCTTCGTCGTCGTCTTCG
CCTTGGTCGGACGTGTAGAACGTCGGCGCCTCCCACTGCGTCTTGCCCGAGTTCATGTCCGAGTAGTATGGCTTCTGGGTCGTCGGGTCAATGTACTTGA
CCCAGAGGCAACCATCGTCGTCGGCCTCGATGAGTTCGTCGGCCTTGCGCTTCTTGCCGCCCTCGCCGTCGTGGCCAGCCGTCGCCGCAAAGTCCTTGGG
CTCATCCCACGTGGTCTCGCCCGTGGTCTCGTTGAAGTAGTACGCTTTGTTCGAGTCCTCGTCCACATGGCGAACCCATGCGC