Description :
From Genome Similarity Track
Location :
Scaffold_79:110532- 116053
Transcript NameFunction/comments
Phyca_LT1534530816mitogen-activated protein kinase 3
Phyca_LT15341171812-oxophytodienoate reductase, putative
Phyca_LT1534128859calcium/calmodulindependent protein kinase kinase pu
Phyca_LT1534555871calcium/calmodulindependent protein kinase kinase pu

Sequence
5521 bases(100 bases per row)
ggcttcaactcctcttcgtcctcgtctcccaaatcttttctggctgctcgaatctcttccgctgggaagtcgttctcgtcgagattattgttgctgcact
cactactggtatagctaatagcgctaccattgcgttcttggtctctggtcaccagcacactcgctctcctgccttcgtctccaaacataggcacgatctt
tgccggttccgttactgcatcccaccctgctgagtctccgagtcgacactgcgtctccacctgactaatcaacttgctaatgcacgaattcaacgtgtgc
aaccacttggtgtgcgcctgttcgtccaccgccgccagtcgtagcacctgtaccccactctcttcctctctgtcttctgcttctgcgtctgccacctccg
tgcgttgatctggagacgccaactgcagctccagcacgtgcttcacctgctggtgggccttcagatccgccacgacgtcgttctgtgacagcgtcacgat
agccacaaggtgaccgggtttcctgttctcgggctggtaccggaactgtcttaatgtaaacttcacatgggtgcccaacgccccttccccgctgcaagcg
tctgttccagtacaaagtaacaaggtctcgagcgccagtagcgctgctgtattaacacggtcagcacgccctcaaccagcacctgtacaggctcggacga
cggcgtgcggacaacttccgtccggcggccgcgctgcaaactgagcgaccgcagaagcgcgcgcataggtgagtccacatgcgccttggtctcttcctcc
tctccgtacagcgagcgaccggtcagcggccgcggggccgaaggagaccgctccttgcgccggaacagacgcgccagcagcttctgcgtccgctggccgc
cgccactgcccggagctgcaggaacaggcgacgacagaccacgcagacgcgtggaggcgagcgaaggcgaagaggacggagagcgcgtggcttgctgccg
cgtcatggcggagagagtcggcgagtgagcagtgtaactattcaagattttactgaagagacgcgggtgagtttctgaccgttttttacgtacaagttgt
gtacgagttgcaccaactgttttaaacacacggttaggtggtcaacttcaactgacagtctccgtcctgatctaatcctaatctagtcttggaggaatgg
gtagtctaaatacccgcgctcgtcaccgaggtagaacgtgtcgacgtcaaagtcgttgacgggtttgttgagctggaagcgacgcaccaggtccgggttg
gagatgaaatggcgaccgatagccacggcgtccgctgcgccatcctcaacgatccggatagccgactgccggtcgaaacctgatgcggcgatcattaccc
ccttgtacgtctcgcggaactgcctggctgatcccttttcgggcgctagagggttgcgtacgtgatacccgcgtggctcgatgaggtgagcgtacgccag
gtcgtagctgttcagcttgttcagcacgtaagtgtacgtggcgatcgggtccgagtccttgtcaccgaagctgccaccgaatggtgacaagcgaatcccc
accttgctggactcgacgctcttaaggatactctccagtgcctcgaataggaaacgggcgcggttctccacactaccaccgtactcgtccgtgcggtcgt
tgatgccatcatgcaggaattgctccagcaaatagccattcgcagcgtgcagctcgacaccgtcaaagcccgcagcgatggcgttttctgcagccttacg
gtagtctgctacgattccagggatttcactagcttccaaagcacgcggtggcacgggctccttacgtccttcgcgcgtgacgatcttcttgccggcacgg
atgttctcgagcttggagctggacgacacgggcagaatcccacccggctggttaagcgggtgtccaatgcgtccagtgtgccacagctgcagaaacatga
cgccgcccttggcgtggacggcgttcgtgacttggcgccaggcctcgatctgctcggaggtgaagatgcccggtgagccccaagacccgcgaccggtggg
cgtgatattggtggcctcggcgatgataagtcccccgggggttgtgcgttgctcgtaatacttgacgccgatctctttctggacaccttcctcacccgtg
cggagtctcgtaagcggagccataacgactcgatggagaagctgcaccgggttcttcccaccaagagtcaaaggcgtgaatagcttggatgtcgtcattt
ggtgttgagagcggcgaaaggaaaactgaggccattcagcgctgcagtgcgctagtgatcgcttcctcccatcggagcttgcgtcatcgcgccagtcgcg
tcataaagctaaagttgcacagataaacctacaagatgcgctaactgattatgcgcagaagcaagttgcttctaagttgcttcaagcaacttccgtttta
agggtaggggtaaatcagaagccgctaatctctctttcaattggctaaatctttttcttagtgatcaacactccgttacatcaaatccgttccgaccgcc
gtctccgtccgtcgccatggggcagcgcgccagcactgcgcgggacagcgacgtctccgagagcgatggaggtccgtcctcctcctctttaccgcctcgc
gcaccggacgcgtctattgctacgcctcaagcgcattctccacctcctactgacgctgacacaggtcgcaaccactcactaaccggtttgttatcgtcca
aacggccagctatcgaccagcccaaggcctccaccgaagagcgcaacagctccgtccccctagtagacgtcgttcacgacgcaattggctctgctaacga
ccaggagccatccgcacaccagctccagagcgacgatgatgacgatttgggctttccgcgcgtggcctcgaccgattccttcccgtccccacccagcaac
gtcaagacggacgacgctcacccgctcaccagacgcagctccatgtcgcgcacgccggggccaccgaaactctcccggttccggccgtcgatggatattg
tcaagcctccaagctccccgcagtccggctaccagtccagctcggattctcgctcattggactcgagttcaagctcttctgatgaggatctcgtgggcag
cggggaagaactcgtcagtgattggctcgatgagcctgaggacgccgtgttgtccccaccgtccctcccgaagcgctcgcgccatgcaagcggctgctcc
tcggtgtcttctcacacagggaacagcgtgtccttctctgctatgcacagcagcggaggacgcaacagcaacagcagccaacacagtatgacaggttggg
cttcgtggctcagctcgccggatgacgtggacgaagaagaggacgcggacgacgaacccgtggcactcacgcccttcttacgggataatatgccagtgta
tgaggtcatgaagcaggtgcagctcttccggaacttgagccagatgcagcaggagcaggttgtgcgcgcgctcaagcctgccaagttctcagacggcgag
gtcatcgtcgcgcaaggcacccgtggatcaaggttctatatgattgccaagggagaagccgttgtgaccaagacagtcactactagcagtcatagtatca
caggatcgactccttcgagtggaggacagacccaagaacgaatgatcacccacctgagagctggtcactatttcggggagctggcgctgatttacgacga
cccacgtacagccactgtgcgcgccgttggcgatgtagaactactgtacttgacgcaggaagatttccagcatatcggccaggtgcatctgagtctgatg
ctgcagcaagtgccgttgcttgcgcgtctgagtgcgcgggaccaggatatcgtgctcaagtgcttgcgacctgcgaacttcaacgatggcgagtacattg
tgcaccaaggagaagaaggcacgcggttctacatgattacgcgtggcgaggctattgtatctgaaaaagctgaggggccaaacaagaagccctacgagaa
ggaattgacgcggttgtacgagggccacgttttcggcgagatgtctctcatttacagtgaaccacgcacggcatcagtgcgcgcggtgggtcctgtcaag
tgcctgtacctgagcaaagaagactttgacaagtgccttctatcagatcacttccagaggttcatccaagaagcgtacgtggagaaggctacgcgtcgtg
ccatgcgccttcgactgcaacagcgcgccaatagtgccgctactttagcgtctactccccaagcaagttctggtgctgagagttcgtctagttctttcac
tgctccaccaccagctccatcgcctgtgaaagccacagaaactaggaaactcgtgaaacagcgcctgaaaaacggtcaggttgtggtgaacaagtacgtg
atcaagggcgatttgggtcgaggcaccttcggacgtgtcaagctctgtgaaagccaggaggatggccagatgtacgcggtgaagatcatgcacaagacgt
tcgtccaacgaatggctggcaaagaagatcagctctatgacgtgctccgtcgtgaggtggctatcatgaagaagctgaatcaccgcaatgttgtgcgact
tgtggaggttattgacgatcctaacagtcaaaagatgtatctcgtacaggagtatgtgcagcacagtcttatggaggaagtgacacaagcgcgtcggctg
gctgagcccattgctaggaagtacatgcgtgacctcctcactggtcttcagtatctgcacttccacaaggtcattcaccgtgacattaagccggagaaca
tcctcgtcagttcagacggtgttgcgaagattgctgacttcggtacggcacgaatgatcatgaacgagacggagacgatctctggagcgaagggcacgcc
tgcgtttatggcgccagaaatgtttaatattgacgcgacgtaccagggccccgctgtggacgtgtggtccctcggagccacactatacatgatggttatc
ggacacccgccgtggatggcagacaacgaaattcttctggccgaacgtgtgcaacgcgtggagctgcgcttccccaaagatgtagagcgtacgatggaac
ctcatttaaagaacctgctgcagcgcatgctcacgaaagacccagcattgcggatttccttgaaggagtgcttctctcacgaatggatcacgaaggaagg
cagcgatcctcttggcttgatcaccccggagaagaacctgactgtgtccatggatgaaagtgaacgtgctattgagaatattccggagcagattgaccaa
cgtttgacggagagtctcgctcaagctcatcaaatggtgaagacccgacaggaaagtgtgggtccgggtgtcgtgcgcacaaacagcgggcggtatttca
ctggtacgcccgtgtcaggaa