Description :
From Genome Similarity Track
Location :
Scaffold_187:11052- 12339
Sequence
1287 bases(100 bases per row)
GCTTCCGAAGTTCGGGGAATGTatgcagcaacaaacacCAAACGGGACAATAGAATACATGTAATGTACTACATTATGTAGACCTCGACTTATCTCGTCG
CTTTTGGAGGCGATCATGCCGTTGTTACATGCAACAACATCGAGATCCAGGATTCTTGCGGCTCGTAATCGCCGTAAACGACCGCGGGAAATTGGCCTGC
TGCGATCTTCACGTCGATGTTTCATGAGCGGTGGTCGAGGCTCTCGTTGTGGGACAACTCAGCTGACTGGCAACCAGTGGTTGACGTCCACTGTGAACGT
CACTGGTGGCGACATGAGTGGCCGTACGGCGCCTGCAACGAAGTCTGGGCCTGAGGCGGGTCAGTGACCGCAGAGCCAGAGACGCTTCAATGCTCtacaa
acagcaaaaatcCGTTCTGTTTGAGCCTCAACCAAGCCAAAGAAGCAGCCAGCGGTGCGCGAAGCTCGCAGTTTGAGCTTGCAACGCTACATCTGGGGAG
GCGGCAGCGCCGATGAGATCGAGGCAAACATGGCAACGGCGGAAGCTGCACTGCGGCGGTCACTGACTGGCGGTCATCGCAACGTCTTACGTCGCATTTT
CCCTGGCGCAATCGCTGCACGTAATCATGTCATCGCAGACAGGGCGGAATGTGGAAATGGGTATTCCGTTTTAAAATGAGACCGTTGAAATGGGTGTCGG
GCCTAAAACGGCAAATGCCTGGCGAACTCTGATGACGGGACAGCACGTGTAAGCGCAAACTCTTTAGCTTTTGGTTTGAACTGTTGGGCAAAGTCAGTTC
TGCGTCAAATTGATGCAGTGCATCATGCACTGCATCAACACACGAACCAAATTCGCGTCGATGCAGGAGCGAGCAGACTATCCTTTCTGAAGTGCGAAAA
CTGATCCACTGATCTGCGTTGCTTAATTGTGTCGCGCCATCAAGTAGCAACGGGTGCTGTATGTACCATGTATGTGTAGCATTCCTGTGAAACCTCTTTG
CATCCGCAGTACTGCGCCAAGATGCCAGTGGTTGGGAGAGCCCAATGGTTGGTTTCAAGCTCAAAATGTTCACTGACCAGCGTACATGAGCACTGGCAAC
GAGTAACGAACGATAAGTTACCCGCTAACTTACTAGGACAGCCAGCTACTGCTCATAACCGCGTGTTCCAGTCGCGACAACACTGCCATCTGTATATTTT
GCGGTTCCGATCGTGTATTTGCTGTTAGTAGCGCTGGCCGGCTTCCAGCGCACATCTGAAACGAATCCTTATAAATGACGATACCGG