Description :
From Genome Similarity Track
Location :
Scaffold_64:11050- 15489
Sequence
4439 bases(100 bases per row)
aagaacagccatttcaccatacgttgcgagatgtgcggcgatttaatcgccgtacgcagtgatgcgtggtcagtgtagaccacgaactgtctactcacaa
gtagatacactcgaaactttgcgagtgcatacttcaacgcaaggagctccttgtcatgtacgggatagttgcgctcagctggcttcagctgacgcgactg
gtagtagaccacacgatcacggccctcgtgatcgtgttgcatcaatgcacatccgatcgcgaaatcggatgcatcacacactacgtggaatggacgatct
tggccgtcgccgaccaagatcggagcctcagccaagccctgcttgactgcatcgaacgccccctggcattcggtcgtatccgctcagcttcctgtttaag
aagctgtgacagcgggcgaatttgcccgcgtagttctccacgtacttgtacaagtacgtggcatacccaaggaactacctcagttccttcacattggatg
gcgtaggccattcattgctctgaccttctctgggtcagggcgcacgccgtccttccctacgagacaccccagcacgggtatctcgctcaccccgaagata
cacttcttcaagttcgcatagagcttatgcttcctcataagctctagcagcttccggagatgcaccttgtgcatctcaatgtccgtcttcccgttcacag
cccggctgtggacgaacacgtcgtcgaagtagctcggtgcgaagtcgcgcaccgagcgcaatagatgagtcacacatctattgaacgtcgcaggggcatt
cttaagtccctgcgacatgacgagccactcccacagcataccgctgggggtgcctaccgctgtgagagggatatccttctcacgcatgaggatttaatag
aatccatcacgcagatctagagcactggagacagtgctcaaggccatcgaatcgatgatgacatcttttcgcggtatcggcgtcttcgccggtatcgtcg
catcgttcaacttgttgtacgcatgaacgatgcgccagccgccctatgccttcttgacacagaacgtcggggcactgtgcggggcctttgattcccgcac
ttgaactgcaagacgacgactctcgaagaagtcgtcgatcgcttgtacttgttcacgcggcagtggccactgccgtgtaacgcaatatttcgtgcccgac
acgagatcaatctcgtgctgtacgcccttatccttcggaagctcctgaggaatctcgtccaggagtacatcctcgtactcccgcagcacctcatggtagg
gacttgacctcaacgagtcccaactctgctcctcgaagcgctgctgcctagtcttcgcactgagggtgtcatcgccctcagtgatcccatcgacgacgag
ctgcttaagctcctcggcctcgcggtccactctctcaatatctgcgaggatgccaatttgttcgatgcgtccatcgaacaactctcgcgcaatgcctttc
cagttcatgactggaagcgcggtcaacgccgacgcactcgtcggtggattctccaaccacatctcccggtactgcaatccagtaccagtacgtgtcaaga
cgttcagcgtctcgacactcggtgtctgccgcgcagaaacaccagtctcagtctccggctgagacgcgcgcagcttcaatggctcgcgccgcgaaaggct
tccctggagccgcgctccaggtgctccgcgtccaaggggctctgccttggacgggtcgtcttcgcaatcgtcagcggactcgctcagctgattcgcacta
tcaagcaccgcttgagtgccgctcatcgcgtgcagtcctcctgcacgtgagcacgcaggttgttcaggtgctggacgtttgcaaccgccagcacctccag
ccaccatgcctccatcaactccgcgagctgatggagcctccacatcgtcgactatcgtagtcgacatgcctttctttagccttgtgtgcttgcggccctt
tgtttgtatcatcggctccctgagccgatgtacgatcgctagctccttgaactagccgcgcgtctgtcacgtcagccgtcgcagctgacgtctgtccgtc
ggttcgttgaatcggaattttattcgcatcgtcagccaccaaggctgacgcgcaatcgtcgacgcgacccttgggggcttgaagtacttccaaggatacc
ggtaataccggtaagttaccgtcactcaggtgattcatattcacctgatttctaagacgacccttcggctcagactcagactcagacatctgagccgaca
cacactttctctcaacgactatctgagtcgtcgagtgtcgccggcggcgatcggaggcagcgacggccgctgctgcctcatccggggagttacatgcatc
ggccgatgcatgtgtagtactgacagggccatcgctctctgtcgcgctcatactattgaagcgtttgaccgtacgcttctcccagttgatcaccgggtca
tgccgtgcaagccacggcatgcctaacaccaagtcgaacttatcgtctagatccaagacgataaggccttccacaaacgtcgttcgtttgtgcgagaagc
gcacacgaaccacgcgcttcttggtcctcacggtggcacctgttgccaaccgcacctccaatacgccgcgaggcgtgtcggcttcttcgaagttcatact
tcgaagacttccctgtcgaacaaaattgttcgacgcgcccgagtccactagggcacgaagagagttaactctcttcgacgtaacatttaggatgacaagg
tttagcttgtcatcttgcaacttgcagcgagaaaccttctcgctgggggcaacagtcctcatcgtcacgtgtccaagttcgacacgcgagactgcatcac
cagtaggacgccccgcacctactggcccatgacatttttgaacgctcgcccggatgcacactcgctgtgcattcgtgtgcaagtgaccgatgtaactaca
cttgcaacatcgtaccttgcatcccttacgctgctgttgaccagcagtcgtagcactcgagacgtccatcggctccggacctcccgccttcggtacagga
cgcgccggtttcggcgcgttcgcatggagtttagcttgacgccggctaaactcctcttgcatcgcaaggctgatggcttcctcgagagtattcggatact
ctcggaagaggtacgtcttgacgggaccgtctctcagtcccttcatgaacgtgacgaccttggtcgcctcgtcgaccgggttggccactatgttcgatac
caagtatcgagcacgctgggcataggaatgtacgtcatccttgccctgctgcagatcgaggaactccgccctcgatctgaactcgttcttcggggctcaa
acgcgaacttgagctcctccttaaaaccttcgtacgtgccgaagcacgtaggatccgagagtcggcgcccataggcccaacacctcgcgcgtccgcccaa
acatgacatggcgaacgtgaccttcgacatcgggtcgacgatacgtcgaaccgcaacggctgtgtcgagttcgacaagccaacgaaggagggtctcgtcc
tccttccccgcgtaggtactcacgtggagtttcaacgactccacgcgtggcttcggggaagccaccgaggcagcaacatctcgttgctccttaacaatgt
accccagagcaacaccgtgttgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngggggagttatctaccccgcgt
tcgtatgactccatacgaacgtacagcaggcggtcgtgggacggactacaaagtgctaccaggtgtaatgggtctactaagtcctattaggtggcgtaca
cgtacgcttacgtgtatgaggaagcgtgcaattagttagacttaaattaattatacttacgaccgtaaatataattaaattaaatataacaatattaaga
ctgcaaaaaaccgtaaaatgagaactgttattgaatttggcataagccaattatggacctcctaaatctgattgctatctgtttctaaaggttctgtcaa
tgtgtggttgacagaattctgatttctcttaagagcactgattggtagaaatatgtcattttctaccaattgcatgcataaatgcacgcgagccatccaa
tgatatggcccgcccatgtatccattggtgtgctccacacaccaaggcctgaggcccgtttccaacctgtaacagttagcgcaactgttagagttacaag
tggtgtaaccacttgtacgtgtaaccctgttgcaaagga