Description :
From Genome Similarity Track
Location :
Scaffold_3592:1105- 2504
Sequence
1399 bases(100 bases per row)
AGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTT
CTTGTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGAT
CCTGTTCCTCAGTTCCACGAATGCGTGTTGATCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCT
CTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAG
CTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCGAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGAT
GAACCGACTGTAGTAGTTCAAACCGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAACGAAGACAGGTCCTTAGGATTC
GCCTCCAATCCCTCCTTAGAAACTCGATGGCCTAAGTAATCCACCTTGTGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTAC
ACGCCTCCAGTAGGAATGTCACTCTCTCGCACAACTGATCCCACGATTCTGCCGGGATTAAAATGTCGTCGATATAAGATCTGCGTCCTAAGACAGACGG
GGTCCCAGGATCCCCTGGCTCTCCTGCTTCGAATGGATCCACTTCCGTAGGATCTTCCCCGGATCCACCCCTTTCGGGTTCCGGTATTCGGGTGAATCCA
TAGAGGGCGTTATCGATCAGGCGTTGATAGATCCGGGGTGTGTTCTTCAATCCAAACAGCATCCGGTTCCACTCGGAAAATGTCAAAACGGTGTGATGAA
TGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAGCAGTACCAGAGTAGTTTATTCAAATCTTCTAAA
AGCTCATTGATTAGGGGCATTGGATACACCATCAATCGGGTCAGGCTGTTAATCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGA
TGATGATTACCACCGGAGATACCCACGGGGACGTTGAGAAGCTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTG
AGGTGCCAACCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACCCCGCGGGCAGCAGGCGGTAGTGCATTACCTTACCAATCAGC