Description :
From Genome Similarity Track
Location :
Scaffold_2536:1105- 2474
Transcript NameFunction/comments
Phyta_totarag14596hypothetical protein PHYSODRAFT_424253

Sequence
1369 bases(100 bases per row)
CGCCGGTCGACTCGGTGGGCGAGGCAAAATCACCGTTGGTGTCTTGTACTGCGATCGGTCAACGGCGGGTCCTTATGGCTCCACAGCAGCGTGGCGGTCG
TCGTCTTTGTCGGTGGTTGCCTGTAAAGCGAGGTTCTGTCACTCGGCGTACCTCCGCGATCTCACTGAGACATATACAGGCAAGCGCGGTGCGCGATCTC
CTGCTAGTCGCATTCCGACGCGCATGTTCTGACTCAGCACTAACTTGCAATCGCTTACGtttgacagcagcaggtagTGCGCCTTGGTCGGGTCGGTCGC
CAAGGTAGGCACCCATCGATCTCCACGGGTCAGCTAAAGTTTCTGACGTTCTGCCTTGTTTGCGTGAAGTTTGACCTCCAGCGAACTTCCGACGTCGATG
TAGAGATCTTCCTTCATGATCACCGGCTCCACGCGATCTCCGTAGAGCGGGCGCCTACCGGACAGCTGGATACGCACTTCTTCGGGAAGGTAGCTGGTGC
CGTCAGCAAGATCGAGGCAGATACCCGCAGGGGCCATGAAGTCCATACCAAGGATCAGGTCCTGGCCGCCGGTAGGTGGGCCCACCCACACATCGAAGAA
GTAGATCAGTGATCCGTCTAGAGTGATCTTGAGTATGGTACGACCATTCGCAATATATGGAGTTTTCCTAACATCTTCGCATGCCAATGTCTGACTTTCG
TCAATGTAGCACCCAACCTTACGAGCAAAAGCGGTGTCGATAATAGACACCTCGACACCACTGTCAAACAGCATGGCTTCTTTTTCGttgttgatcttct
ccatTCCTTTCGCCtgttgaacttcttgtcaTGCACGTGGTACTTCCAATAATCACGCGATTCTCCCGGTATATGTCCAAGTCCAGCATCACCTTCGATC
TTGAATATTCGTCGATCTTATGAAGACTTGACACAGCGGAGGTAGGTTTCTCATGAAGATCCTATGCATTATCGCTTGGGTTCATCAACTTGCTACCCGT
TGACTCCGTTTACTTTCGACATATGCATAGACGCCGTACCTAGAACGCTCGCCTCGTACCGGGTTCAAAACCGGCGAATGTTCTAGTTTAACatcttctc
cgccgtctccagcagcatgccTGCGTACTTGGTGGGGTTGAACCACTGACGGGTTAAGTTGTAAAACCCTCCATCGGACACTTCTCGGCATCATTAATCT
CTCCGCTCGCCTtgcacacgaagaagcaaCGGTCGGACGGACAGTCCTTCCTGCCGCCCTTCTCGCAGATCAAGCGCCCCCAGCACCTAAGGTCGGTGTG
CTGGCGTGACCCACAGTGCGAACAGCGTTTGGGTGGCGTCCCTTCTTCTGTCGATCTTGGGTGGTGATC