Description :
From Genome Similarity Track
Location :
contig_162:11049- 22397
Transcript NameFunction/comments
g11833.t1hypothetical protein
g11834.t1DEAD/DEAH box RNA helicase, putative

Sequence
11348 bases(100 bases per row)
CTGCTTTTTGCCTTCTTCTTCGCTGTCGTCGATGCCACAGGCTTTGCCTTCCTTTTCGCCGCCCTCGATTCCGTCTCCTTCTCAACACTGTCGACATCCA
TCTCCTCCACTTCCTCGTCGTCATCATCATCTACTTCGTCGGGATTAAAGTCGCTGTCGTCGTCCTTGGTAGTTCTCGTGACAGCCAGTTTCTTTCCAGA
GCCAGCGGACGTCTTCGCGGCAACAGCTCGGCGCTGCTCGGAGACTAGACGCTTCTGGGCCCTAAGGTAAGAAACGTCCTTACCCGTCGGAGGTCTTGCC
GGAGGTTTCCAGGTCTTGCGGGGGGCAGTGCGCGGCTCTTCAGCCGCTGATGGCGCCTGGTTGTCGTCCCTGAAGTCAACGTCGGTGTCGCGCTCTCCGG
CCAAATAGGCAGCATGTTCCTTCACAAGATGCTGCCGCTCCTCTGGGTTACGACCACCCAGACGTTCCAGAACGCGCTGGTGCTGAGCTCGGGATTCTCG
CCGGGCCTTATTCCTCGCCATGCGTCTCCTGCTTTCTTGCGTTCTTTTTATTTTTCTTCAAATGAACACCAGCCATCTACCGATGCCAGTTTCGTTTATG
AGCGGTTTATGCCTACCCCTGTGCATTTGCGGGAAAGTCTCGGCTTTGTCAGGATTTGATTAAATTTGAGTTCACTATACTTAGCCGTTTTCCGAGCCAA
CCCCTATTCAAACATGTTGTACGTACAACATGATTCATGTTGTCAAATACAACGTGTGGGCGTAGGGGGTTAACCCTTTCGTGAGCCACCTACCTTAACT
ATACTATACAAAGTTAAGATACTGGTTTGTAGAAGGAGGCAAAATGCCTCCTTTTGAGGTGGTGATGGGCTCTCCAGCTAAGTACGCAGTCAGACAACAC
GACACCTGTAGTTACATTTTGCGGTAGGGCTCTTGTAAAAGGAGGCATTTTGCCTCCTTTTACGAAGACACGGTACTGCGTCGGCATGTACCTGATTGGG
CAGATTCGACTCCTCTTCAGTGATTGGTCCAAACGATCCAATGAAACACCACAAAAACCACGGCCCCCAACGTAAATTTCCCATCGCATATGGTATCCTT
GCATAGACGTGCATCTGCCGGGAGCAATTATGTGGAGCATTTGTCTTTATTAAACTATACCGACCACTCTGAAGGCTGTGCAAACCGCTCATTTCCTGAT
TTTTTTCTCCCTGTACGAAATGGCGCGAAAGCACGCGCGCGGAGAAGAGATGCCAGCCGAGCCAAAGCGGCGGCGACCGCGGTGTGATGCAGCGTCCCAG
GACAATGACACGGCACGTTTAACGAGGGTGCTCGACTTCAACGGCGTGTGGAAGGAGCTGAAGGCTGCTGGATGGACGCATAAACTGCCACGCGGTCTTG
ACAACCGGTATCGGTACGTGCTACCTGGTCGCTCTGCCAATGGAAAGGATGGCGAGGACTTCCTGCTAGGCGAGGAGACTGTACTTCGGTACTTCATTCA
ACACAGTGCTTCAAGTGGCGGTGATGGCGGCGCGGCGACGGCCACGGCGGGACGGCAGCAAGCAGTCGGTGGCGCGCGTGGACTTGGCGATGGTGACGGC
GGATGCGGTGGGACCGGCGACGATGGCGGTGATCGTGGACCTGGTGACAATGGTGTCTGCCGCATGGCAGCAAGCCATTATTCACGTGAGCCTGGCAACG
ATGGTGTTGTCGCGGCATCAACCGGATGGCAGCAAGCAGTTGTTGACGCGCAAGGGCTTTGCGACGATGGTGGCGGCGTTGTGGCAGCGGGACCTGTCGG
TAGTGCCCGCGGTAGTGTTCGAGTTCGTGGGTGTGGGCGTCGGCGCGGTAGTGGTCTTGGCCGCGGACGCGGAAGCGGTCGCGGAGATCGAATTGTCAGG
AGCGTGATGGAAGAGGCGGCTACCGCAGCTACCGGGGCGGAGACTTCAAGACGGCAAGCGAGCTTGTGATTGAACCCAACCTAGAAACCCCAACGAGTGT
CCCCACGCGCAGTACGCCGCAGAGACGTACTCCTCCTGCCCCTTTGATGGAGCATCTATTCCTAAAGAAGCTGGTGGCATTTTCACCGTCAAAGGAATTG
TGGATGAAGGAAATATGTATAGATGCGTGGGCACAGCCTTTATTGTCGGCCGTGTGTGTCGTCAGGTCAAAAAGACGAAGAAGGGAGGGGTACTACAAGT
AATTTGGCTAGATACGCAGTTCCAGAATGCAGTTGAAACTCTGAGTGTGGCAGTAATTCAGCGCGGGATCGAGAACTACCAGGCTCTCGCGCGCTCACCC
AACAAGCCGGCGTGGCGTGAATTGACTGATACAGTGGTGGAAGGGGAGCTGCAGATGGAGGAACCGCTCGATGAACTTGAAGTCGCGTCAGACGACGACG
GTATGGAAATGTACGATCCAGAGCGATTTTTGCCCGTGAGCCTTGCGGAGGTGGAAGCGGTGAAAGTATGCGGTTTCAGCCAGATGTGGATATGGATGGC
CCCACGGATCTGTATGAACACACGGACGAGAGCACTAGTACACGCTTACTACCCGAGTACAGTCACCTGTTTGCACACTCAGCCTCTTCGAGCTTCTTCG
CTTACATTCCAATTTACTTCTGGAAACAAGTGGTTCTGAGACGAATCGATATGCAGCCCTCAAGAATGTTCGATCACCACGCCGTTTACAATGGAAGAGC
TGATGATCTTCCTCGGCATCATGCTTTATCTGACCCTCACTGACAAGGGGGAGTACTCTAACTACTGGGGGCCACAGACTGAAGATGCGATTTTTGGTGG
TGCATCTACCAGCTTGGACAATGTGATGAGTCTAAATAGATTCAAGTTGCTTCGCCGCTGTTTGAGCTTTCGCGCTGATCCGGGATCGGCTGTGGAACGA
GACCCAGCAGCCCGAATTAGGCCCCTATTGAATTTGCTCAAATGCACTGGTGGTCGCTATGTTGAGCCTGGCCGTGACTTGGCTCTTGACGAAGCAGTAT
CGCATGCCGGTCCCGCCATGGACGACATCTTATCGTGTTCAATCCCCAAAAGCCTGGCGGCAAGTATCATTTTCGTATGTACGTGCTGTGCTGCTCGACC
ACGTGGATCGCTTTGAACTATCGCCTCCACTGCAATAATAGTGATATCGCGGACCGCCTGCAAAACGTGGTGAGCCTAGAAGAGGTGCAGCAGCTTCGTG
AGGAGCTCGAGGATGTCAAACAAGTGCGTAAGCATGTTCTAGAGGTCGTGAGGCCCTACTTTTACTCTCGACGAATCATCAATATGGACAACTATTACAC
AAGCGTCCAGTTGCTGTTGGATTTGCGTTTGAAGGGGTTGTATGGGCGGGGAACTGTTCGGGGAAGGAGTAAGCACTATCCGAAGCACACTATTCTCCAG
AAGGAGCACTCAACAAGGGGTGACTATCAGCAGTCTGTCTCCCTGGAGCACAACTTGCTCGGTGCGTCGTGGTGCGATGGCAATACCGTGATGATGGTTA
CCAATGCTGATGCATCTACTGCCGCGACAGTCACGCGGCGGGTTGGTAAAAATACTCATGAGTTTCCTGCTCCGAGCTGTATCCTGCAATACAATCGACG
CATGCAAGGTGTTGATCGTTTGGATCAGATACGAGCTAGATTTTCACTAGCTGATGGTCATTCGTTCAAAAAATGGCATAAAAAATTGGCTTTGGCAATA
GTGGATATTGCACGGTCCAACGCGTACCTGACTCGACGGATGGCAATCGACACTTCCAGAGATCGAGATCCCCACAGGACGTTTGTCACTGAATTAGTAT
CTGAGCTAATTTCTGGCAGGTGGCAAGAAGCCCCGAGCGATAGTCAAATGGCGTTTGGAAGCGGTGTTGCTGATGAAACCGCAGCAGTGGATGCAACTGG
TATAACTCCTAAAGTGTACACTTCGCCAAACCCGCACAGCGCCCTGAAGCGATGTCAGTCTATGCCTTCGAAACAAATGTTCAAGGACAGTGGGCGGAAA
CGTCGGCAGTGCATTGTGTGTCGCTACGAGGGCAGATATCCTACAGAGGTGACGGATTATTGCCTCACGCACACTGTTTGTCTTTGTAGCACTGTGCATG
GATACATCGAGAGTCCGTACACGTGCCCACAGAGCACTTGAACTTGTTGGGATAAGTTTCACAGATTCTATCTCCCAAATGGCCTCTTCAGTGACAATGG
AAATGTCAACAGGTCATCGCATCTGGCTAAGTTGAAGGCAAGTAGCGCCGCGAGACCCGTCGATAAAGTTCTCCCTATCCCGAAAGCGATAGTGTCGTGC
TCTCTTATGAGACCCAGAGCGACAGTTCTGTACTCTCGTCGACGAAACCGACCTACTTCTCAGTAGTGATTGTGCAGAGTTGCTCAGCGAAGATTCAGCG
AGTCAAGACAGCAGAGATGCGCGACAGATATTCCAATGATTCGCATTCTGTAGGCAAAGAAGAGGGTATTTATCTTGATTAAAGTATGCTAATGCCTTCA
GAGCAACATGACCGAATATATATCGAATAAACTATGGTCAATGTCTTTAGCATTATCAACAAGTGTTTCTCGTCCCAAATAACACAGTGGCAGCGTTGCA
CCCACGGCCATCGCCGCGGGATCTGTTCGGCCATCATCGCCAGCGTCAGCTCCAACTGCAGCTCAGTGCCCGCGACGTTCCTGTGGTAGGCCAACTGCGC
CGTTCTGGGCATCACCACGGCCTTGACAGCCCCGCCAGCCGCGTTGTGTCCGTCGTTCCCTCCTTCACCAAGTCCATTCGCGCTGAGACTGCGGCCGCCC
AGTCCATCCAAGCTGCAGCTGTCGTGCGCCAAGTCCTTTCGCGTCGCGCCCGCGCTGTGGACGCCGTAAACATGTGCGCAAAGTCCAGCACACGCTGTTG
CCGCCCGGCACCAAGTTCAGCGTCCCGTGGCCGACGTTCCTGATATGTTGCCGCCGTGCACGCAGCTCGGAGTGCCGTGGCCACCATGCCCGTGTTCGCT
TAGTCCTGTTGAGCTGCGCTCGCAGTCGCCAAGTCCCGTCGCCGCCCGCTGTCGTCTAATCCAGCCGTGCCCGTGCGCGCCATATCCAAGCTGTCGTTCA
CAAAGTCCAGCGCGCCGTAGTTGCCGTGCCCGCTTGCACCAAGTCCAGTTGCGCCTTGACCGCGATGTTGCTGCCGTGTACGATGTCCAGCGCGCCATGG
CCGCTGTGAATGCGTGCGTCAAGTCCAGTCGCGCAAGTCCGTTGCAGGCTTTTAGCATTGTTTGTATATGTATATTGGAAGTGGTAGTGCCTTCCAACTG
CCGCGGCCGTAAGTAGTTGCCGTCAATTTCCATCTCGCGCAAAAGCTGTTGCGGCATGATTCACGGTGGCGGGGGCAATACTTAGACGTGGATACTATCA
GTCGGGCTCTTGGCATGCGAGTAAGCTCTTGTTGCACCACGAGCTTGGCGGCTTCATCAAACAGGAAATCATTAAGGAAAATGATGGTTGCATCGTGAAA
TGGTGCGGACGACCACAGCGGCGTATCGCGTACGTCCCCAGACTTCAGACTTACCTTGTGCAGAAGCACTAGTCGCGACGCACATGATCGCACGCACTCA
TACCCCCTGCGAGCAATATCCACCCTTTTCTCGATCCCCAAACACTGTCTAGCTTTTGTCTGCAACGCGAACTGTGCAGCAACATTTCCCAAACCAGCGC
CTATGTCTAGAAAGACATCATCTGGCTTCACCGCTCCAATACTTCGAATGATACCCGACACCGCAGCAAGAATCATCTCCCCGGCATTTCCGTCAGTTTT
ACCTGCCTCCTGGCGCACATCAGCAGCCAAACAGCTCCAAAAATCTCACGGATGGCTCTTTCAGCCTGGCTTGGGGACAGGAGGCAAAACTTGTTCACAT
ATTGAGGCGTTGGCGAACATGTGGAAAAAAAACAGGTAGGGAAACGCCCGAGGTCGTTACTGTAGGTACGCTTTAGAGCGCGCAATCTCATCTTGAGTTG
TGCTGCCGGACGCTTCCTGCGCATCTTGAGCTCGATGTCCTGCCAGACAACGCGCTTGCCGTGGGACTCATACTCGAGGGCACGAACAACGAGCTTCTTG
TCTTCTGCGTCGGAAAAACTTGTGCGCATCTGAAACTGACGATAAATGAAAGAGTGAAGGCGAGCATCTCACCTCAGTATTGTATGAGATAGGTTTGGAC
GCCCGAACTGGTGGCGCAGCATCACGCGGGTCCAGGATAGAATTTGGGATGGGTCCACCTCGTTTCCACCACCTGTACCCACCATTTCCTCATTGCGTTT
CATGTGAATGACCGCAAAACCACAAAAATCACGGGATATGGGGTGAAAACAGGGCGCTTTCGTGCAAAATTAGCATTTAAATTTTGATAGTCGGCCTCAA
ATCCTCGAGTGGGAACACCTAACCCACCCGCATCTAAAGATCTGATTGGCTTACACAAAACACGGTCTACTGAAACCCTGGTAAAAGCTAAAAGGAAGCA
AAATGCTTCCTTTTAGGGGGTCCATTTTCACCTACTTTTGTGAAAGTGCTTAAAGGTAGCAAAATGCCTCCTTTTACCACGAAAGGGTTAAGAAATTGGT
AGCAAACGCGACAACTTAGAAAGGTTGCGGACTACCCAAGTCATCAGCAGGTATCTCTTTGAACGAAAATGTATGTCATCTGATGCATCGTTCCATCGAG
GAAATGCATTTTAGAAAACTATCTCGTTCCGCAGTAAGTGAAAAATGGTTTGGCGCCTTGGGTGCTGCTTCTATTGTGCGCGTTTCAATCAAGCCGAGTA
TTTCATCGATGGGTGATACAATATACCGCTAAATAATAGTACCTCCAGCCATCAAAACAGGTGGAGAGACTTCGGTACAAATAGGTCGTGAGGTCAACAA
AGATAGCATCCAGTGCACAGACATCATTGTTCAGTGTCTCAGCAGGCGATCCCCAGTTGCCGACTCAACTACAGTGCCAACTACATGTAGAAGTACTGCA
CATCAGACCAAGACCTCGTGAGCTATTCAGCAATGTCCGCCCAAGAGAAGAGAGGCTCGACTACATCTTGCAACATCATCTACTCACTAGTACCAGCCCA
GCCGCTTCCAGTCGTTGACCTATCCAAGACGTTTCGAGGCCGGCTTATTCCTGGCAGCGTTCACACATACATCCGTCGCCGATACTACCAGTACTACCGA
GAAATCTTGTTTTGCGCAGCAGTATCCTACTGCATCAACGCCATTGTGCCCATGGTCAAGGCTCCAGTGGGCTGCGTGATGTCGATATTGGCCGTTCTCT
TATGGCTCCCTATGGGGTTGGGAAGTGTGACGACACTGAGATACGATATCGTGCGCTTGGTGTGTCGAACGTTCGACTTCTGGTTCTTCTCCGTTGTCAC
AAGCGTGATTGTAGTTACGATGTCGATGTACTTTGGAGATTTGCGCTCGGTCCGGACGGTGATCGACTGGATAGGATATCATCACGTCATTTGTGTTGAT
GCTCATGTTCTGGGCCTCCGCAGTCTCACTTGCTTTCTGATCGCGGCGATTTTTTCGGTGTTCGTTGCACTTGCTTGGATAATGCTTGGGCACGTGGATA
GTGGCTCAATCTTTTCAATTCTCAAATATCAAACCAGACATGGCAATTTTGAGCTCTCGGGGCTGGATGTGATCGGAAACGGACTGGTATCACTTGGATT
TCTGCTTGCAAAAATTGTGCTTCGGAGACGCAAAGTTTTGCGTTCTCATCCCAAAAGACCAGCTATCGTTGAATGTGTCATTTATCGCGCCATACTAAAG
CTGCAACCAGTGCAAGCACCAGCAGAATCGTCCGCGTGGGAAACGAATGATTCCATGTTCAAAGCAAAGATGTCATCCTTGAGAGACACTGATATCGTGC
AACATTTAATGTTTGTCAACTTTTCTCAGACCTTCGCCGCGAGTAACACGCTGCTTCCTTGGCTAACGGCAAACAAACGTCGCTTTCCGCTGTGGTCAAT
GGTTGTGTTGTATTCAGTTGGAGCAGCTGGACTGATACTTTCTCACGTCGCCCTTGCACACGAGTTTAATGAATCACATGATGATCCTACAGCACACGAA
GATTTTATATTGATGGTATCATCAAGCGCACTGCTGTGCACAGGCGTGTTCACATCTCTATTTGCTGGATTTTACCAGCCCCAACTACTCAGTTGCTCTT
TACTTCGTTTGACTTCGTGTTTTACTCCTTTCAAGTCACGTCTGCAAGTATCTCTGTGAGCGTCTTGTACAGCTGGGACGTCGCGCACAGCTTGATGGTG
ATTTCGTGGTGGCTTTGGGCACACTGGGTATTCACCTTAGACGCGTTAACTCCAGTCATGCGGGAAATGCTTCGATTTCGTAGTTGGTTTGCCGCAACCA
TATTATGCTTATTGCTCGCTGACCACATCGCAATCATATGCCGGATCTTCTTCGCAGGAGATTTACGACTCCAAGACTCGGTCATCTTTGAGGGCACTAT
TTGGGGTCAGCAACTAAGCTTTCGTGTGATACCTTTTTACGTCAGTCGATCGTTCACATTGATGTTGTGGTTCTCTCGCTTAGTATACCGGCTTGGCTCA
GCATCAAACGACGATGTCACTATTCTTCGTGGAACTGTCTGCTACGACAACGTTTTCGCGAAGGGAAGACGAAAATTTTCGCAGATTGCTCATATTGTCG
AAGCCAAGACATCAGCAGCAGCTTTCTCTCGACGAGCTAGAGTATCGCCTGCTATGTCGTTCCACCAAGATCCAAGCCTAATGTGACACCCAACATATTT
CTGCATGTAGGATGTCCAGTTAATCACTTCGATCTGTCATCAAATTGCCAATACGGCGATCCGGATACTACAAAGCGACTGCATAACCAGGTGACACCTT
ATCATGCACGATAGTCCGCAAAATCTCAGATGTGTCCGAGTTGATACCACCACTTGATCAATCCACCAAGGTCGGTTTCAACATAACGGTGCATGTGAGG
GGTTCAAAAGTATCAGGTTGCTCATCACTCTCCCTCGACCATTCTCTCTGCCCTCATAATATCCGCTAGCACTGTCAAATCGGCAAACCCATCAACAAAG
TGCACGTGAACAGGAATATTTAGGTTGAGCCTTGGTTTGTTGCCCTGCAAGAGAGTTCTCATTGCTGTTATTTGTGCGAAATAGTGCACGCATGCTCTAC
TGTGTTTCTCTTGGTGGTGCAAACAAACAAAAATTGGAGGATATCTTCAGTTTACCGTCGCGTGCGGCACTCTTCTTCGGCACACCACTGCTCGTCCTTG
ATTAACATATTGAGGTGCCTGTACCATCCACGCCTCGCAGCATTCCGATCCAGTGTCCCTCGTACATTTCATCCCCTTCGTGACCCAATGGCACCGCACA
ATGCTTCTCGAATAAGTATCTCCATCCTTTGTAATCCATGTCTGCGACCGCAGTCAGTAGAGCCAAGTCCTCGCGAGCAAGTTCGAATGTATCTGGCCCA
TCATAAAACTCGAAGCGTTCTTCGACAGTTGCCCGGACTGGCACAAGTGCTTGGAGGTAACGTCTCGGGTAATCACACATCGGGCGGGTTTGTGTTTGAG
TGCGGTACACCACGGCACCATGAAGCCCCACCTCTAATCTAGATCAGTATCAAGAGCAGCACTACTGCGTGTCATCGTTGGGTTATGCAGGGCGCGATAG
TTGACTTGAAGCAAATTCTCAGCAGCGAGGTCGGCGGTTTGGTTACATTTTTATTGGAGCAACCGTTCTGGTAGCGAGGAAGCCCGTGGTGTTCATGCCC
TTCTCCATGTATTTAAGTACTTCTGTCGAATTGCGGGTTTGTGCCCGCGTTTGATTATGGCGTCAAAAGCAGTGCTATAACGATGCTTGTTCCGAGCAAA
GGCGATAGCGCTCAGGAGGGCCCCTCCTGAGCCCTCTGGACAATAGCACAAAGGCGTGATAAACCACGAGAGCGAGTTAATCATGAGACCGAATCACATC
CAGTGGCAAAACAGGAATCGTGGTCGAGGTTATCAACGCTAACCGCTCTGAATAATCAATAGCCAGTCGCACCGGATACTCGAAATGAATTTGCTGACAC
TAGTTTAACGAATAAATCATGGCCTTGTACGCCGCCGTTTACTCTTCTGACTGTCCCAGTTCTTCCATTCTGATGCGTGCGTACCCATTTCCTTAACCAA
TTGCTTCCGAATTCGGAAAGCCCGTTTAGATTCATCGATCACGACTTCGATGGAGCGAGCGCGCAACTTGGCATTCTCAGTGTGAATACTCTGGTACACT
TCGTGAGGCACCGATACTTTAGCTTGCCGCAACAGCGATACAAGGTCCCAAAAAACTGATTGGTCATCCTTATTCACAAGCGTCAAAACATTTCCGGTCG
AATCATCTCCACGCCCGATACGCCCAACGAGGTGAACGTAGTCTGACACTTTCTTGGGAAAATCATAGATCACAACATTCTGAACGTGCAGCAGATCCAT
TCCACGGCTCAGCACGTTTGTAGACACGAGGACAGGGGTCTCTAGATTAATAAAGGCCTCCAGCAGATGAAGTCTTTCGCTTTGAGTTTTATCTGCATGA
ATCGCTGCTGCACCAATTTGACAGCGTTTTTCAATGGCTTCAGCCAGCATGCTCGCGCCAAGTTTCGATCCGACAAAGACAATCTACAACGCCAGCAACA
CAAAAAGTATCAGCCACCCGTCAATGATGTCAGCTAGCTTGAAATTCCATAAGAGTCAATGCAATCACCTCACCCACCGTTGACTCTTCGTATTTCCCTT
TCAAGAACTCAAACAACTCACTCTTTTTCACCTTGTCGTCCGACCATCGAACCTGTTGTTTAACACGAGGGTTGAGTGCGAAACTCGGTGTCCCAGTTGT
CTTCGAATCACTGCGACGAACGTCGACGCGAATATAATTTTGCTGGCTTTGAACTTGCAAGATTTGCCGCACCATTTCTTCTACCTCGCCAGCGACGGTG
GCGCTGAAAAACAGCATCTGGACGCTCTTTTTCCCAGCTAATGCTACCAATAAAGCCACGATTTGAGAAATCTGTGGACGAAAGCCAGCGTCCAGCATAA
TGTCCACTTCATCAACAATACACATGCGAATAGCTGCCAGGATAGCATCACCGCCACTGTAGTTCATGAAAATATCGAGGAAGCGCCCCGGTGTCGCCAC
AATAAGCTGAACTCCACCTTGTAGTCGATAGCGCTGGGTGGGGACAGGGAATCCCCCACCAATAGCGCCGTCTTCATGTCAGCTATGCCTCTCACCAGCA
GCTTTGCCACCGTCTCAATCTGAATTGCCAGTTCTCGCACAGGAGCCA