Description :
From Genome Similarity Track
Location :
Scaffold_296:11045- 27870
Transcript NameFunction/comments
Phyag_g4416conserved hypothetical protein
Phyag_g4417hypothetical protein PHYSODRAFT_475011
Phyag_g4418hypothetical protein PHYSODRAFT_554371
Phyag_g4419hypothetical protein PHYSODRAFT_474636
Phyag_g4420hypothetical protein
Phyag_g4421hypothetical protein
Phyag_g4422hypothetical protein PHYSODRAFT_475526
Phyag_g4423hypothetical protein PHYSODRAFT_471379
Phyag_g4424Avr4-associated TDF-like protein

Sequence
16825 bases(100 bases per row)
GGTCGATCCGTTGGCGTTTCTGGCTGCAccatcttcacctcctccacatCATCTTGACCGgtaacagcagcatcaccactgctgctattTTCTCCAGCAC
TGGTGTTGTTCTCTGTTTGTTCCTCCTCTCCACTCTCCTGAACCTTCATCTATATACGAGCACAGCCACCAAATCAGACCGTGGCTCCATCACAGCTTTG
GCTAGTTCACGCACCTGTTCGGCAACTCGATGGAGCTTCTCCGCCACTTCGTCCGGTAAGAAAATGTACTCTCCGTCGATCTGCATATTGTTGTAGGCCT
CCAGAATCAAatcctccagcgcctcgaccatctcgtccacctcctcctcttcgctCTCGGCAGACGACATTTCTGGGGCCTGGGGCGCCACCGACGGCTC
GTTAGACTGCACAGaggcttgagcagcttcagtgGGTAACGTCTGCAGTTCTGGATccgtggcagcagcgccagtcTCGACGCTGGCGCCGTCCGCCGGC
GGCTTCATTGCTCGAAATTACTAACTGCCGAGCATGGCGTTCGTATGGCAATCACTCCTAAACATGATAAAATGTGTCTATATTGATTTTTGgagaaatg
gctacatgaccacttcaacatgtagGAATCAACCTTTTAAAATCACACGGCGCTCTCCGCCTGTGCCTTCGCCAGTTGCATGTCAGCGAGGTTGTCGACG
GATGTTGATGCCGCCGGTCGCTGTGATGATCCTCCGAACACCGGCTGCATGTAAGTTGTATCGAAAGCTTGCCAGTTTCGGAAGAATGCACCGGTTAGCG
AATCGCCACGAGATCTCTCTGCAACACGGCTCACGGGCGAAGCTAGGTTCgggtcgtcttcatcgtcgctcgTGACGTCGTGAAACTGCGGTCGTGGAGT
AAGTATTGGGACATCGTCTCCGGTGCCGTCGATATTCTCCTTGggttgttcttcttctgggaACGCCAAGGagccgccgtcgccatggcgTGTGCTGCGC
TGGACTAGCCGTGACAGAGTCTCCTCAGACTCTGACGCAGTCGCAGAACTCCTATCAGTGTCGGACTGGTCGAGGTGGCTATGATCCTTGTACTTGCCTG
TGAGGTGCAAGGTCGACAGCAACGGACCCATAAGACCGCCAATCACGATCGTCGTAATGAGAATCACCACAAGAGTCGTAGACTCGATCAGCCGGCGGTG
CGACGCCCCGTGCAGACCAACGTAGTTCCAGTTCTTGGCCAGAGCGAAAGCCATGGAGCCGCGAAGTCCTGCCATCCAGATAACACTCATGTACTTGACC
GGAATCCGATTCGCGGGAGAACGCAAGCAATTGCAGAGGCTCAGTAGCGGGAAAATGTTGAAGAACCGCGCGACGATGCAAGCCACAAGGGTGAGACCGA
TGAAGGACCAGTCGATATCGTCCACACGAAGCGCTGCACCAGTCTCTTCGCCGTGGCCCGCGAAAATCATGATCACCGACGTTCCCATAAACACATACAC
AATATTCTCGCAGACAAACgccagcgtgtgcagcagaTGCGTAAACGCATGCTGCGCTTCCCTCGACAATGTGTTGAAATGATAATGCGCCGTCATAGTT
CCCGAGAAAAATAGCGCCACGATACCACTCAGCTTCAAACTGTCCGCCACAAAGTACGTCAACAGACTGAAAATCAGACACAGTGAGATCTCGTAACTCG
GGTAGTAGCGCAGTGTCGCGAAGAATTTGCGTTTGAGTAGGAAGGCTCCTCCGAGCGTAATGAGAGCGCTTACGATCAACGATCCCACGAACATCCCACC
CGTATTAAGCGCCACACGAAGCAATTGTTTGGCGTTAAGATTGCTGTCCGCATCCCACTTGTGCAGCGTTTGGTACAGAGCAATAGCCACCGCGTCGTTC
ATCACACTTTCACCAAACACCAGATTAAACAGCAACGGCGGCGCGTTGAGCTTATCAAAGCAGCCCAATGTAGCCACCGTATCCACTGCACTAATGAGCG
TGCCGAACAGGAAAGCCTCGACCCACGACAGCTTGGTCACCATACCAGCTACTCCCGCGAGGTATAGTACTCCTCCCGTGATGGTCGTGGCGACTACAGT
ACCCAGCACAGCTGTACTCATGATGGCCGGGAAGTTGCGGAAGAAGACCGTGCACTTGATGGAGAAGCCGCCTTCGTAGATGATCGGAGGCAGCAACACA
TTGAAGAAGAGACTGTTGTCCAGGTTCAGGTGCGTGTGCAGCGCCGCGTGCTTGCCGCCCATGATCATGAAGAGCCCTACGAAGAGCCCGAACATGAGCG
CAAAGCTACTCTGCGACACCAGCATGCACGAGTAGCGCCCTAGCATGTAGGACGCCAtcaccagcacgaacagcatgagcagcagcagcaccgcgtcCTC
CATCGTGGTGGCCTGGGTGAATTTGACTCTGGCTTCATTCGATTGGTGCAGCTCATATACGCGACATGAATTTTTAGTCACCACAAAACCGTATGATTTG
CTGAACGCAAAGCACTTGAATTCACTATGCTTTGATTATGTACAACACACAAatacaagttgaagtggaccgTTATGCTGTCTGCATCTTGCTGCCTTCC
TGTGCATGGCTATCTGCTGTATCTTCCTCGGTGACTGGTCTCGGATTCGCGGGAGACTGAAAACCGCCGAACATCGGCTGCATGTATGCCACGTCGAAAG
TTTCCCACCTGCGGATGAAGGCGCCAGTCAAAGTCTCGCTGCGCTCCGTCGGCGAGTCTCCGTCGAGTTCTCCCTCCTCGTCACTGTAATCCTCGTCTCG
GAACTGCGGTCGCGAAGTAAATATCGGATCTCTATCCGCCCCCGTCTCTTGGTCTGCTGTAGTGTTTCTCTCTGAGGTTGTTTGAGTGACAGGAGGCTCT
GCAGCCCTGGAGTTTCGACGCAGCATGAAATGACGAGTGCTGCGTTGCAACACTCGCGCGCGATCTTCATCGGAACTCGAATCGCCTTCAGGGTTCGACT
CCGGCTCAGATTGTCTCAATGCGCTGTGATGATTCGTGAGACGCAGTTTGTACAGAATGGGACCTGTCAGTCCTCCGATCACAATTGTTGTTAAAAGCAC
CACGATGAGTGTAGTGGACTCCACGAGCTGTCGGTGGGAGCCGTACCGACCAATGTAGTTCCAGTTCTTAGCGAGAGCAAACGCGATTGATCCTCGAAGA
GCGACGAACCACATCACACTCATGTACTTGACTGGAATACGGTCGGAGGACTCTCGAGAGCAGTTGGATAGTCTTAAGAGAGGGAAGATGTTGAAGAATC
GTGCCACAACACACGCTACCATCGTAAGGCCAATGAAGTGCCAGTCGATGTCATCCACgcgaagtgcagcgccagAATTCTTCTCTGGGTGTCCCGAAAA
AATCATTATCACGGATGTCCCCATGAAAACATACACGACGTTCTCACACACGAACGACAACGTGTGCAGCAAATGGGTAAATGCATGACGAGCCTCACGT
GACAGCGCATTGAAATGGTAGTGCGCCGTCATAGTTCCCGAGAAGAACAGCGCAACAATGCCGCTCAACTTGAAACTGTCAGCCACATAGTACGTGAGCA
AACTGAAAATCAAGCACAAGCAGATCTCGTAGCTGGGGAAGAAGtgcagcgacgagaagatttTGCGCTTGAGCAAGAAGGCACCGCAAAGAGTGATCAC
CgcactcaccagcagcgacccCACAAACATCCAACTCGTGTTGATAGCCACTCGAAACAACTGCTTCAAACTCAGGTCAGTGCCAACATCCCACTTGTGC
AAGGTCTGGTACAGCGCAATAGCCACTGCATTATTGATCACACTCTCTCCAAATACCAggttgaacagcagcggcggcacgTGCAGCTTATTGAAGCACG
ACAAGGTAGCGACCGGATCCACCGCATTAATCAGCGTACCGAACAGCAAAGCTTCCACCCACGAGAGTCTCGTCACCATTTTGGACGCTCCGGCAAGGTA
CAGCACGCCACCCGTGATAGTCGCCGCCACAACTGTACCTAGCACAGCCGTGCTCATGATGGCCGGGAAGTTGCGGAAGAATGCCTGCCGTTTAATGGAG
AAACCTCCTTCATAGATGATCGGAGGCAGTAGAACATTGAAGAAGAGACTGTTGTCCAGGTTCAGGTGCGTGtgcagcgctgcgtgctTGTCCCCCATGA
TCATGAAGAGCCCCACCACCAAACCGAACGCCATCGCGAAGCCGCTCTGCGACACCAAATTACACGAGTACCTGTCCAACACGAACGACACCACtaccag
cacgaacagcataagcagcagcagcaccgcgtcCTCCATCGTGGCCGCCTCGGCATCTCTCTCGGGCTGCATTTTCACTTATCATGGCGATGGGAACTGT
GCGGCACAGGAAGCCGGAGCTCATTTTTATCGTTAAAACGTTACGAATTATTGCTTAAACGGACCGGCTGTTATTTGGTGTGACGAAGCAGCTGTAGACG
AAAAAGCTGCAACGTCAGACATGCCTCGTGAAGTTAGCGGTGCTCGAATCTCGGGGCGCGTCGAGGTCTGCCACCTCCCTTCTTGAAGCGCAGGATGCCC
ATAACTAGAGCCGCGATACTGCAACCAAACCTGTACGCATCATGTTGTTAGTGTCAAATactcgttctcctcttccagAAAGCTCTTCCTTACCAGGTTG
CGGCGTATCCGGCATGCTTTTCGGGCGTCATGTAGAACTCCAAATAGGAAGCGATGTTCTTTCGGAGAGGgttgtccagctccacctcgcCATTAACCCC
GTCaacggctgcagcaaggaATTGATCAAGTTAAAACGTGCTGTTAGGTTTCTAGAGAAGCCACGCGAAACGTACCGAGTGCGTCAACGACGACAGGAAG
ATCGGTCGAAGTGACGCCCATGGCGTTGGCCATCTCTTCGTGGTCCAAGTAGAAGAATTGGCGATTTTCGGGAGCGTTGTCTGGCGTAAAATTGTTTTTC
TTCAGCAGAACGAGGTAATGCAGAGTTAGAACTTGCATGAGGTAGTCGTCTATCAAGTCTTGGCAGGCAACGCAAATGTACCTCTTCACCATGACGAAGC
ACACCGACAAAAGACACTTTGCCACCatcctccttcttgtcgcggGCCATGTGCACGTCCAGGAGCTTGCGCGGGAGCCAACCTCGGTTCACGATCACTG
GGGTTCTACATACGCACAGACAGCCAAATCGTAAATTTCAAGGTCACTCGGACGTGGAGACTACACTGAACAAGGTCCCCCTTACCCatcttcacgctgc
agcaacgaatAAATGTAGCCGCCAGACTTCACTCTTGCCACCGAATCACTCGGATCAGCGGGCGCGGAGCGAGGGTCTAGTCAGAAGTCATTCCACGCCG
CAATGTTAGACAACTCCGCGTCAACAATCACCTGACAGTGCAGCATTCGTACACAAGTAGAAGGTGCTTCCAGGTTTGAAGTTTCCCTCAAGACGAAGCT
GACGGTACTCAATGTCATCACTGCGCAAATACAAAATCAAACACCAAAATTCGTGAGCTCCTTGACTCCAATACGAAAGCTGATGCCACCACTTAGTCTC
ACATGTCATCACTAGCCGTCGCATCCTTCGGCAGGTCCGCAACCGACTCTGACAACTCCTTCGTTCGCTCATTGATCAAATCCACCTTCCAGTAATAGCG
CTCGGTCTGCAGTTCACATCCAGCATTAACATCTCACTCCACCAACACAACAGAACACAGAATACGCACCTGCCACGTGCCGAGGTACGCTGTGGTCACT
GACTGCAATTATCACAGCAAGCAGATCCATTAGATCGAAATATCCCTTTATTCCCGATCAAACGCACCACAGCGCCGAAGAACGCCATGCCAGCGTATCT
GGAGAAATTGCTCTCATCCCCACTCGATCCCCCGGACTTGGTCTGTGACGCAGACGCCGCGaagcgcttcgacgccgtcgacaaACGCGGCACTGCGCGC
AGCATTCGTCGCCTGAGCATTTTCGAGGCGTTTCAAATTGACGAGCGGCTATGAAAGGCGAGCGAAATTAAAATTCAATTATTGTACTGGCCACGTGGGA
TCGTACACGCTACAGGTGGGTTTTGTATGACAGGCCATAGGTTTCTCAAAATAGATTGGATTGATTTAAAAGGGCCACCAAAGTAAAGAGGGGATTCGTG
GCTTTACAGCAAGGGTTCGGTCATTGGCTGAGAAGAAAAAATGGAGGAGATTCTGCGCGTCAAGCACGAGCTGTCCGCtgccgagaagatgatggtggCG
CGGTGTCATCACTACTTAAAGCGCGAAAAAGATGAAGGCCGCGCCGGATCGCAGCGAAAGGTGCGGCAACGGGTAGCTGAGTGCTTGGGGATTGCTGAGA
GCACGGTAGATCGCATAGTAGGCCACTGGAACGCACACCACGACCCCGGTTACACCTCTGAACCGCATCCCCGCGGTCGGCCACCCCTGTCATATCCAGC
GAACCTGGTGACCACCATACGAGCGATTGTGAACGAACAAAACCGCGAAGTGCTGCCTACTACTGTGAACATCATTGCCGACGAGGTTAAGAAGCGATTG
GGCGAGGAGTACCCGAGCAAGACGATTAACAGAGTGATGGAATGCAACAAGTTTCGGTTTGGGCGTGGAAAACTGCGCCACTACTCGGCAGATGATGTTG
GAATAGTCGCGTTTCGCGACTAGTATCTACGGAAACGACTAGAGAACTATGATCGCAAGGGAAATCCGCGCACCCCAAAGATTTACCTTGACGAGAGCTA
CTGCAATTTAAATCACGTCGCGCGGAGAGTCTGGATTGACACACAGCAGAATGGTGGAATACACTATGAACGTGGAGGAATTGGGCCAAGGCTATGCGTC
GTTGACGCAGGGATTGTACGCGCAGAACGTGATGTCTTGAGAGGGGAATGGATTCCAGGCTGCTTTGTGTGTTGGGATTCGATAAAGAGGGCGCGCAACA
GCAAGGACTATCACGGAAATTTTGATCACCAACTATTCGAGAGATGGTTCAGTATGATGTGCGAGACGGCAGCACAAAACTATGGGGCCTGTCATATCTA
TATGGATGGTGCGCGTTACCACAAGCGCCACCTAAACCCCCAGCCTACAGCAGcctggaagaagatggagattgCAAAATGGCTGACTGATCACTGCATT
CCCTTCGAATCTGCATGGAGAAAGGCAGAGCTCATCGTACTTGCTCGCCAGCACAAAGAGCTACCACGGTATGCAAGCGTTGAGATTGCACGAAGACTCG
GCCACAATGTGTTCTTCACTCCACCATACCACCCTGAACTTCAACCCATCGAACTGATTTGGGGAGTGCTGAAGAACAAGATCGCGTACGGCCCTGCAAC
GTCAATGAACATTCTGAAAGAGAAGGTAATTGAAACTCACAGCGAAGTCACCTCCAATATCTGGATCGGGGCGTGGAGAGCAGTGCGAGAGCAAGAGAAG
CACTACCGGGAGCTGGGAGACGATATCGTGTTGCCTTCCGATGGAGGGATGGAATGTTCAAGCGACAGCGAGTACAGTGATTCGGCAGACATTTGAACAA
TGTAAACCCAATTATTTCTAAATTATTTTCATAATTAGGCGTCGTCTCGTGGATCACTGAATCGGTGCATCATTTTCAAAATCTTGTGGCGAACACAATA
ATTGTGTAATTGACCACCAACCAGTATGGCTTCGGACGCCGAAGGACATGTGCTCGGCAACTTCCATGCGTACTACAGCTTCAACCCGGTGCACGAGCGC
TTGCGCTTTATGGACGTGCAAACGGCTAATGCTCTGAGACGTGCACTGCTGGTGAAGAAATCTACCGAGGACAAGAGCGAGGAGACTTGCGCTGTCATTG
ACATCGGTTGCAACGAAGGAGACTTGACCATTGGACTCTACAACGCATTGAATGGACGTGCAGCACTGGCAGACGCCAACCAGATTGACGATGTGGCCAA
CTTCGACCTCACCAACATCAGTACGCTCAATGAGCGCATGCAaaaggacaagaagcaggtggAGTACTTGATCCAGGACGAGGGCGAGACCAGTCACCGC
AGACGCTACGTGTGCGAGTTGCAGATTGAAAGCAAGACTATGGGGCATGGCGAAGGTGTGTCGAAGAAAGTAGCCAAGGCCAAGGCAGCTGAAGTCGCTC
TGAGAGTGCTGGATGGAAAAGACGATACCAAgcaagagaaggaggatgGATCAAGAGATGAGAAGGTCGTGCCAGAACAGCTACCACTGACGGAAGAGGA
GTTGGCGACGAGGAAGCCGCTCATGGTTCTTGGGGTTGACATCGACGAGGTGTTGATTGAGCGTGCTACGAAGAAGCCTGTGCAGCTCACTGCAAAGGAT
GCTGTGCAATTCCGTCACGTTGATGTCATGACGAACAAGTTTAGCAAGGAGATCGCGCCGttcctggagctggcgaagCGCTCGACAGCGGGGCGGAAGT
TCGATCTCGTCACTTGCTTCAGTGTGACGATGTGGATCCACCTGAACAATGGAGATGACGGCCTCTGGAAGTTCCTCGAGACGGTCAGTGACATGACCGA
GCACCTTATCATTGAGCCGCAGACGTGGAAGTGCTATCGGTAGGTGCCATGTTATAGGTATTGTCGGGAACATCGAATTAGCTGCTGACATTTTTTCttg
ccaacagcaacgcgcAGAAGCGGTTGAATCGCATGCGCGTCGAGATCCCCCAGTCCTTTCGCGAGATCAAGGTGCGCACggacgtcgtggagaaaATCGA
TGCAtttctgctggatgctggCCGGTTCCACTACAAAGCTCAACTGGGAAAGACCAATTGGTCGCGGAACGTCGTTCTCTACAGCCGCAAGCCTGTGCCC
GGGATCACTTACGCGTCATGAAGATCAGCACATTACGTGGCAGGCACCGTGGGGTGGCAAAGGTGCCCCCATAATCAGGTCAATGCAGTGTGTATCTATC
TCACATGCCCCTGACATCACCAATGATCAGTACTGACGATATGCAAGTATCTGTCTACGCGAAGCACATGCCCTTCCTCATTTCCGAACAAGATGGAGGC
CCTGCAAGAATACGGCGATGCAGTATACGCCGTGGTCGTCCTGCTTGTAGTGGCTATCGTGCCGGCGCTGGTTCACGTGCGACTCGTGTACACTGTCCTG
TGGAATGCGTTTACCTGCATCGCCATTTTGATGAAGTCCCCGACGGCACTAGGTCTCGCCACACCGGAGACTTTCTACTGCACTTCGTTTGTCCGTTGGC
TGTCGCCGCCAAATACTTGGAGCATGTCGAAGTGTGGATGACGCTGCCGATCGTGGGGTACGTAGAAAATATGTGAAGAATATACCGACTCGAAACACTA
ACACGACAACTTTGGTTGGTTGTTTTTGGCCAGCTTCTCAGTGCTGTGGGTGTACTTCGTCGCGGACGGTTCGTTGATCGCCAACCACGTTTATCACTTC
TCGCCACCGCGCCCCGTACAGTTCTGGGCCGTGGCGAGCGCCTCCATGCTCGTGGGCAATGTGACGCCGCCGCTTGGCTGCGTGCTCGTCCAACGGAGCG
GCGTGCCTGAGCTGCTCATCCACGGCATCCAGCCGTTGCTCACTATGGCCGTGCCACTCTACCAGGCTATTATTCAGTGAGTAAGTTATACCACCGCAAG
GAGTGATCGATATAAAATCAATGAGCTTCGATACAGCAGCCAACCTGCGGCGTAGCCAAGTGTAAAGCGATTCGTTGAAGTTTGAACCATAGTCGTCTAC
AGCAAATTCACGAAATTTGTTTTGTAAATTGAATTTTGGCATAATCTCACGTAGAACGGGCTCCTGTtatacaaaaatcaagtgTAGAGTCTAGTGTCAT
CAATCGCGTGCCGACATTCCGAAACGGACAGGACTCACTTTGCAATCTGATCGTAGCAACTACACCACGATGGACACCGCCGAGTTATTCGCCGTGGCGC
ACGACACATTGGCCCGCACGGTGCTTCGAGTCCGCGACGGTGAGCAGCGAGCAATGGCGCCACTGGGTCCAGATGCCGTCcaggcggagctgctgctctt
ctccatggcgctgctgcccgtGGTGGTGCGTGTGCGGATCCTCTACACGTTCTGCTGGGTGGTGTTCACTGTCTTGGCGCACGTGACCGAGTCGGAGGCG
GCACTGGGCATGGCCACGTCGCTCGGACTCACCATCATGATGGGCTGGTACTCGCTGCGCACACTCGACCGGACCACGTTCTTGGGCATTCTGCAGGGCT
GGTTTGGGTTTCTGAGCAAGTATCGACCTTTCCGACTGCTGGCCAACTCGGTGGACCTCCTGTTGCACATGGGCGTGCCGCTCACGCTCGCGTTCTGTTA
CCTGCCTCTTGTTCGCGTCTGGATGACCGCTCCCATCTTGCTGTAAGTGGGCTTGCTTGTCCACTTTTGAGAGCTGTTGACGTTTTATCTTACTGTTTTT
ATGCCGTATTATTTGCTTGTCGAGCAGGTTCTCTCAGTTGTGGATCAAGTTGGTAGCTGGTGGAGACCTCTGCCTTACGGGGAACGACGTCTACCACATT
TACCCACCGCGCCCCAACACCTTCTGGATAGCGGTCCGCAAGATCGAGCTGGTCTACAACTTTACGGTCCCGACGGTGTGTGTGCTGCTTTACCAGGCAG
GTGTCCACGAGTTCATTGTCAACCGCTTCCTGAAACCAAGCATGTAAACTGCCAAGGAGCCTTCGCCGATATCCCCCCCCACACTCTAAGACTAGACAAT
CTAGACTAAATGTCCCTTTGTAGTAAAGGACCACTATCGCTTTTACCAACCGCGAAGACAACGAAGTTTTCAAGTGCAACGACATCCCTATATCCCAGCC
ACGGATTGCACCAGCATGACGCGCTACAAGGTGCATCCGTAGTCCAGTCCATTTGATATCCTAAGTGGCGATACTAAAAACAAGCAAATCCTATGATATC
AACAAATTAAACTTATATCGAGGCTGTGAGTCATTTTGCGACTTTcgaccaagcagctcaaagaTGGATACGCTGCTGGGCTGGGGGACACTGGGCCGCG
CCAGCCGCGAAGCCGTGCAGACCAATGACCAATTGGACGCCGCTTTAGCCGTTGCGCTTCTCTTCAGCGTCGTGGTTCTGCCTCCTCTCGTGGGCATCCG
CACCATGTACACCAACTGCTGGttcgtcttcactgtcgtcgcGCACCTGCTGGCATccgaggcggcgctgggtATCGCCACGTCCATGGGCATCACCATC
ATGGTGGGCTGGTACTCGCTGCGGGTGTTCGACCGCTTCGCCTTCACTGCAATTCTGAACGGCTGGCTCGGGGTCTGGGCCAGTTCCCCGCTGCTCGGTG
TAGCTGCTCGTGTCGGGGACTTCGTTTTGCATCTATTGGTGCCAATGCTACTGGTCTCGTGCTACTTGCCGCTTGTCCGTGTGTGGATGAGTGTGCCGGC
ATTAATGTAAGTTAGGAGATAAAGGGAAGTGCTGGTGGGGGTGTGATACTGAtggttttgttgttgttgtggatGATTTGTTTTGTGTAGATCGTCGCGA
CTGTGGAGCCACTTTGTCGTGGGCGGTGGAGTCTTCCCCAAGGCCGATCACATCTATCGCTTCTCCCCGCCGCGCTCGCAGCACTTTTGGAATGCAGCTT
ACAAGATGGAGCTCATGCTAAATCTTCTCGTCCCGCTCTTCTGCGTGCTGGCACACCAGGTACTGCATTGACACGTACTACGCACCGCTGATTTTACCCA
GTGGAACTGGGTGTTGCCGCATCATTGACCCACATAGTTCTGGCTAAAACTTTTTTTCTAATATCATGTTCGTCCTTGTTGGGCGTTGTTTGATGTTGAC
ATGCAGAGATCCTTCTGGGTGTATGTCGCGACGGCGATTGCGGGGGCGATTCTGTTTTGTCTTCAGCTGATCCGATCGCTTTCGCTTCCCAAATTACGGA
AGAATGCAAAGACGATCATGTGTCGTTTGCtgtccagcggcggcatCCGCCCGAATGTGGTAAGTGACTGTTTTCGTTTGGATCACTGCCGGCTACCACT
AAAAGTCGTACTTTGGTGTAGGACTTTATCGTCCGAGACGACTCCTTCTGGTTGGATTGGATGAGCGAGGGGCTTGTGGCAATTGGCGAATCGTATGTTG
GTTGCCTGTGGGCGACCAACTCTGCCCGAACTCTAGACGAGGTGGTTGCTAGCTTACTCACTATTCCGATGGAGGGCAGACAGGAAATGTACCGGTCCTG
GAGTGCCCGGTTTGTGGCATTGGCAGCGCGGTTGTTTAACTACCCACCATCGTCTATGGGCCTCGTGGTTGGCGCTGTATCGGAGCAGTTTGACCTGTGC
CCCGAGTTCCGACAGGCGTACATGGACCGATACTTCCACCAAGGCTTTGGCCTTTGGACAGCAGGGACAGCAGCCATCGACGTAGCGCAGACCAACAAGC
TTGCTAATTTGGACCAGCTCCTGGACATTCGGGtaagtgcagcagctccaccattCGTCGCTGAGCCAGCATCCTAACTTTTTCTTCCTATTTCAGACTG
GTCACACCGTATTGGACATTAGCATCGGATCATGGGGTGGGGTGGGCTGTTACCTCGCTCAACAGCACCCCAACGCCACTGTTGTCTGCGCATTGTCTTC
AGTCCAAGAATTTGCACGCGCCAAAAAGTTTGCTCGTGAACTCGAGGTCTTCGATCAAATGGAGTTCGTGCTTGCCGAAACACCAGAAAAACTGCTCACC
ATTCTGAGTAGCTTCCGCGCATCCAAGTTCGACCGTATCACATTGTGTGGTGTAGTGGAGACTGTATCGGACATCCAGCGAACGCGGTTCCTACGGACGT
TGAAGCGCATCCAGACCGCGAATGGCACGACGTTGGTGGAGTTTAGCGCTTGCACAGCTGCGCACATGACGACCCACGCCTGGACCAACAAATACGTGCA
TAGTGCATTCCCTTGCTACGCCATCACGCTACCGCTTATGCGCCGACTAGCTGGTGAGACGGGCTTCACGCTTCGAGACACGCTCGGGTACTCGGATCAC
TACGATCGCACATTCCTCGAGTGGAACCGTCGATTCCAAGCGCAATGGGGTCACGACTcggcaccaacttcaactggcCAAGCCACAGCACCACAACAAA
CGACTCAATTGCAGCGGATGCCGTCGCTCCCCGAATCCTTCAAACGCACGTGGGAGTTTTACTTGTTGCACTCCGCTGCGTGTTACCGATCCGGTGCACT
TCAAGTGTTTCAGATCAGAATGGGCTAAAATAGAACCTGTGACGCCCACTAAGTGGTACAAATAAGTCGACTGTGATTGGTGACCTTTAACCTATCAAAT
CGCGAGTCTCGGCTCGCCCCACTTAGCTGGTCGAAAACAGGTCGTTCTAGTTTAGAACTCTTTTTGTTTAGAACAAAGTAATAAAGTAATAATGGCGACG
GACTCCATGGTCGGCGATGGCGGCGAGTGGGAAAAGCACGTAGACGACGCGACCGGTTCGGCTTATTACTACAACGCTCGCACAGGAGAGTCGTCGTGGA
AGGTTCCTACAGGTTTCAAGTCTCCCCAAGCACAAAGAACGAGTCAAAACAAGGCCCCAAAGTGGCGCGAGTTTGTGGACGACGCATCTGGAGCCACTTA
CTACTACGACGAAGTGAGCGGCACCAGTCGATGGGACCAACCGGAAGACTTTGTACCTCAGGACACGGATAACAATGACCAAAACAAAGAGAAAACGGGG
GCTCAGACATGCCAAGACCTCAAGACAACTAAGGAAATCgatccagaagaagaagagatcgaaGGACCAGAGCAGGAGCCAGTAGAGAAGGCgacgcaga
aggaggagaaggaggaggaggaagaagaagactcGCCAGGACGTGATGAGAAGAGTAAAGGCGAcgcctctgctgctgttaaTAAGGCATCCCAGTGGGT
CAAGTACGTGGATGCAGCTAGCAAAAAACCGTACTACTACAATTCCAGGACAGGGACTACGCAGTGGGAGGAGCCTGAGGGCTTTGATGAGTCAGCAGAT
TCAGCTCCTGTCGTTCCTCAGGCGTCCGCAGAGTACCAGGCTCATCTTAACCGGGTGCACACGGAACGCCTGGCTCGGGTgacgcagcaagtgctgGATC
CGTCGGGCAATCTCAGCAAATTAAATGCCATTTTGAGTGGTATTGACAGTAgtgctgctccttcttctaCTGTGGTAGATGGGGAGACTACTGCTGATGC
tccacgaacagcaaaagcGGAGTGGCAGCAACATATCGatgcgcagacgcagcgatACTACTACCACAACGTGGTCACCGGGGTCACGCAGTGGACCAAG
CCTGACGCACCAGTTGTATCAGGGGTAAGTTTGTGTGTGGTATTTGTCTTTCTACGAAGGTGCTCATGATTCTCGTGTTGCGATTCTCGGTTTGTGTAGT
TGGCCGATTGGATCCCTCCTGAAAACCCCGAGTCCGATACGACTGGTGCAGGTCAGAAGACCGTCTCGGGTGTCAACTATGTCGCTCGGGCGAAGTTCAA
TCGGCTAACAGGGAAGTACGAGCAGCTTGGAGGTGATGAATATTGGCAGAATGCTGGAATCGCACCTGATCGTGAGGGGCGGCAAATGAGCCACTTCTTT
GACATGACTGAGTTAGAGAAGAACCGCGAAGAAGCTCGTCGCAGGAAGGAGCAATTGAAGCGGAAAAATATCGACTGGAAGAAAATTtcggcggagaaga
aggccaagaagcaaaagcagaGGAACGAGTGGCTTTACACGGATTAACATCGACAACCGATATGTGCTTGCAAAACTGGATCTGCGTTGTTGTGAATAAC
TATCCAGCTAACTTTACGATAAGGTTCGTCTATCTCGATTCTACCTGTTCCATTTGCTCTACCAGGAACAAAGTCGATAAGCGAATAGCATCCCAAGAAT
TACTGACCCGGGTGCACGCCAAGGAATCCCGGAGTCGGCTCGCCCTGCACCTCGCCAAAGTACAGCGTGAACGTCtgcttccactgctccaccaccgcgc
GGTCCGCCATGAACTTGGGGAACTCATCGACGTTCGCCTTGCATATCTCCCACGGGTGGCTCGATCCGCTGTTCGGGGTCAAGTCCACGCGCACGTTCTC
GTTCATGACCGACTTCTGCGCGTCCTCCGAGATGGCCCAGTTCATAAAGAGCTTGGCGGCCGCTGGGTGCTTGGCCTTGTTCAGGATGGCGATGCGCTGA
CCCCACGCCAGATACTCATTGCCACCGTCCGTCACGAACGTGACGTTGGGTGTGCCCAACGAGTACGTGCCAACACCGATGACCTTGTCTTTGGCTGTCA
CGAGATCGCTGGGCGTGTTGGATCCGCGGCGGAACGTGACGTTCTGGTTGGCAAAGTCCTCGACCCAGCTCCAGCCGTACTTCTCCACGTAGCGTTTGTA
CAGGAAgagcacggcgtcgtcgtcgttcggGTAGGACGAGACGATCTTGCCGGCCCACTGCGGGTCCACGAGATCGGCTGGCGACTTGGGTGCCGGGAGA
CCGTCAAGTGCTGTCTCGTCATACaggaagctgaaggtgaacATCATATAGGCCATGTATGCGCCACGCTGGTCCCGGAAGCCGTCGTAGACCTGCGAGA
AGTTGGCAGGTTTGTACTCGAGCAATTTGCCCTCCTGTGCCCAACGAGGGAAGTcctgcagtgtctgcagcgcAACGAGGTCTGGCACGAGCGTGTCGGT
CTGGAGTTGATTGTCGATGCGCACGTCATGGTACTTGCTGTAGTCGACGATGAGCGTGAAGTTGATTTCCGGGAAGGCCTTGCTGAAGGCGACATGcgtt
gtttgttgctgcgaCGCGAAGTCTCCGCCGTGATACATGACGAGGTTGCCTCCTTCggcgatggcgtcggcgTAGAGCTCGTCGAGGGACTTGGTCTCTT
CCTGGACAGCGAAAGTGGTGGAAGCAAGGAGCGCAAAACAGGCAGCGGCGAGCGGCGTGAAAAGATTCATGGTGAATACGGTTGGCTAGTTGGTCTTCAA
ATTGAGGTGGTTGGTCGCAGGccaattgaagaatgaggaAACAAGGTTTGCTTTTCAGGTGCTGTTGGCTGGGGCTGGGTTGCAGCAAACATGTTGATGG
TCTTCCTGTTAGCTCGAAGTTCATTGTTCGAGCCTCAACAGTGGGCGATGGATAACGTGGCACGTCAAGAGAACTGTCGCATCGATTACTAAAATTCAGT
TTTGAAGGATAAACAGTAAACATAGTTACCCGTCGTATTTCGCTggagtacatgtacttggcAATACTTCAGTAGAGATCATTGATACAATGACAGTTTA
TCTGGTTCCGCGCCGAATTTCTAGCACGGCACTTGCAAGTTGCAAGTTGCAACTAGAAAACCTTTTGTGTGAAGCTCGAGTTGACTTCCAAGGCAACCCT
ACTACAATCAAGGTTGTGCCTCACGGCGTCCCGCCTTAACCAGCAGACAGATAGTTCATCGCCTTTAGACCATCTCCACCGGTCCAGGCTGCAGTTTTCC
ACGTGGGTACTTTGCCTTTCTTCATTGGCGGTGTCTGAGTTCTTGCCGCACAATCAACCATATACGCAAACACGCGACGCGTTATCCTGTTATCGACTAA
AAGATCACTACATATCTTCCTTTTCTGTTTTATCAGCTGAAGCAGTGTGAAAGTGCACCAACTCGGCACACAATCATCCCGTAAGCATCGAAAGGTACTA
CGTAACATATAGCTAGCGAAACGAT