Description :
From Genome Similarity Track
Location :
Scaffold_72:110423- 112920
Sequence
2497 bases(100 bases per row)
GCCTTCTGCGATCCTTCATCCATCGACCCTGTGTTATCTAGGGGCCGACTCTGGGGATCACCCCCGGTCTTGGATCCAACCTCCATCGCTTGGACCTCAA
TCCGACGATCCCTCTGCAGTATCTTTCGCGGAGTTCGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCCCCGCCGGTAGCTCCACCTCTCCGAGAGA
TTTGATCTCGGTAGTCGCCTCATACGCCAGATTCTGCCATTCTCTGTAGCGACGGGACCCTACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTC
GCCAACCATCGTCCGATCTCTTCATAATGGTCCAATAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCCTGGATTA
CGGTAGGCACCCATTTCTCGCCTCGAATGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGATCTGGCAGCTCCCAGGTTTTTCCGGGCTCGATCCA
GGTCGTCTTATCTGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCA
TCCGCCAGATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCGAACCAGTACA
CCAAACAACCGGCCAACGTGATCTTGATTCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCAC
TTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATTTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCT
ACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCTAACATCCTCAGATCCAC
GGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGTGTTGCTCCCAATAACCACG
TGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAATTCATCCACTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGA
CTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGG
CGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCA
TCGGACACTCGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCTCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAG
ATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACCTGGGCTGTCCCGTCCATGAGATCTCGGGGTCTGTACATCCCA
CGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGGCGCAGTGAGACAGACTCGACGGTAATCTTCAGGAT
CGGAGTCCGAACCGTCGGATCCTGACTCAGCTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCG
ATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCATCTGCGTCTGGAAGACGTAAC
AGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATCCACATGTTCCCGCAGTACCTTGGATCCCCCTATCCTAGATCTTCAAC
TTGGCCCGTAGACCGGCCACATTTAGTCGATGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCA
ATCCACAGTACTGGGTCTGGAAGCTGCGCAGCAAATCCGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAG
CAGATCCGCAAAAGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCGCGCTCGGTCTTCGTCT
TGATCCTTGCCCGTGAACGCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGGTCATAGACGATCCACCCGCCCCGGCTGCGGCTGTTGCTACCA
CCGCTGATGAAGGGGATTGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACTGACTCCATCTCCACGTCTCGTGCTCC