Description :
From Genome Similarity Track
Location :
Scaffold_223:110409- 123172
Transcript NameFunction/comments
Phyin_T30-4PITG_21010Eukaryotic translation initiation factor 3 subunit%2C putative
Phyin_T30-4PITG_2101114 kDa zinc-binding protein
Phyin_T30-4PITG_21012Putative uncharacterized protein
Phyin_T30-4PITG_21013Kinesin-associated protein%2C putative
Phyin_T30-4PITG_21014Putative uncharacterized protein

Sequence
12763 bases(100 bases per row)
TAGTGCTTCTTGCCACCGTTCTTGGACTTGCGGATTTTCTTCTTGGCTGCAGGCGGCGATCCAGCATCTTGGTTCGACTGGGTCTTGAGCTCTAGCTCAC
CGAGTAGCTCGTTAGCAATCGCATCAGCCGCCTCAGCAGCATCAACCTCCCGACGGCCCTTGGCACCCTCAACGGCCCTCTCCGTGAACTTGGCCATGAA
CTTGGCCGACTCAATCACTCGCGGGTCCTCGTGTCCGAACGCCTCCTTCATGAGCGAATACACCTTCTTCTCGTACATCAGAGCCTCACGGTAGCCGCCA
GCCAGACCGCACGCCAGAGCCATTTGATGGAGAACGTTAGCCGCTTGATTGCGGTCAAACTCGCCGCGACGGAGAGACTCACGGTGGCACATCAGAGCCA
GCGTAATCTGCCCCACATCCTGGCACATTATACCCATTTTGAAGTAGAGCGAGCTAATCTCAGGGAAGTGAGGGCCGCAGCAGAACTCCAGCAGGTAAAT
AGCACGGCGGATGTGTGGCACCGCCAGGTCCGTCTGGGCGTTCGCATGCAGGAACAACGCCAAATTAGCGTGCGCGTAAGCCGTGTCATGATAATCGATA
CCTCGGAGCTGTGTGTACAACGCCAGTGCTCGCTGCTGCTGCGCAATAGCTCCAGCAACGTCACCAGCGTGGTAGAGTACAGTAGCGAGCGACGAGCTGC
AGAGTGCAGCGTCCTCGTGGGCTGCACCACACACCTGGAAGAGCAGAGATGATGCTTCCTGAAGAAACTCGTATGCACTTGACAGTGCGCCCTGGCTCAA
GTGCATACGACCACGTTCAAGGAGCTGCTTAGCACGAGTCAACGGGTGTGCAGGCAAAGAAGTCTTGACGACAGGCACGACACCACTAATGTCATCCAAG
CTGATTGGAGACGACGATGAGAACTCGTAGTTACGGCTCACCACACGGAGACCCAGACGCTGACACAGACGCCGCAACATGACAGACTTACTCACACGGC
CAACAAGGTAGACAGCATTTTCACCACGAGATTCGTCACGGCCAGGGCCCCAAAGAGTCAGCTTGTAGTCGAAGCGGGCCTTAATCTCCATGTCAATGCG
CGTCCACAGCGTCTTGGAATCCAGTGAGGTCGTTGTGGTAGCATCAGTACTACAGGTTTCGTCTGCCTTCTCCGAAACAGCAGCTGAGCTCGATCCAAGA
ATGCCGTTGAGGAGCTTCACAATGGCGGTTCCCGGGGCGGCCCGAATGGAGTCGTTGGAGTTCAAAACATCAGCCAGGATATGCTTCGCAACACGCGCGA
TCATCTCCACCTCAAGTATCTCCAGCAAGTACTTGGAAATACCGCTAATGGCCTCTAGCTTCTTGGCAAGCGAGGCCAAACGACCCAGGTAACGCATGTT
GATACCGCAAGAGTGCATCAGCTGCGTGAGGGCGTAGCCATCGGCGGGGGCTATAGCTCCACGACGAACATCAGCGACAAACGCCGGCACAACGATCCGC
TGCATATACTCCGCGGCGTCCTTCGCCGCTGCCTTGTCAGCCTCACGCTGCTCCGAATCGGTGGAAGCCGCATAGTCCATGAAGACGTTTGGGTTGAGCA
GCACTGGAGGGATCTCTTCGTCTTCTTCTTCCTCTTGCTCGTTCTCCTCAGTGTCCTTCTTCTCAGCATCATTCTTTATCGAGGCGTTATCTTCCGTACC
CTTTTCCTCCTTCTTCGCAGCCTTGCGCACCTCACGGATGGCGCGGCGAGCCTGGTTTTCCTTCCAGAGCGAGTACAGCTGAACCAGCTCCGGTCGCAGC
AGAGCTGCATAGCCTTCATCATTACGCGTAAAGCACAATCCGTCCTCTTCAGGCACAACATCCTTATTTTCCTTGGAATTCTTCCTAGCAGCGCCGCGGT
TCTTGTAAAATGTCCAATCCTTCGGAGTAATGCGGACGAGATCCAGGACATACAGACGTCCATCCGAGCCTTGAATTCCCTTGGCCTCAACAGCACCACA
AATGGTGGTCACGTCAGTGCTGGCCTCACCACTGCTCACGAGGGGTATATCTAAAGCCTCCTGCTCCTTCTCAGCAGCCACATCTTCTTCACTTTTGCCT
AGGGGTTTGATGCTACGCTCGGCGATGTGCAGTTTTTTTCCTGCCTCAAGCATGAGCTCGTGCATCGTGCTATTGGATGCAATAGTCTTTCCGTGGTCCA
CCGAGCCATACACAAGCTTCGATGCAGCGTCGCCCATCAGGATTCCCGGGATAAGGCTCTGGGCAATGACACGAACACCAAGGTAGTCCACCACAGTCGT
GGCCAAAGTGTGCAGATCCCTTACATCGGCATCATTAAAGGCCTTGACACCCTGTAAGTCGCGGTTGGCGGCCGAGTAGGCATTTTCCTCACCTCCAGCA
GCGTCCTTGGTAGACTTCCCGTCAATGGACACGGAGAAGAAGATATTGTTGAAAACATAGACGTGAGCACTCTTGTCGTCCATGGGGTTGATAGGAGGAA
TGTTGCCCTCGACAATTGCCACTGCGCCCTTAGTCGCAGCCTCCACAAACTCCGCAACAATCTTATACATGACACGAGCACGCACAATCTCCGCCTTCAG
TGTGTCCTTGGGCAATTCGCGGCAGCACTGGTATTCTTCATTCCAGTCGCGCAACACACCACGCTCGTCCATGCCGTAAGTGGTACAAAGCTCATCTTCG
GCACGGTTAAGGTCATACGAGTGCTCCTCCATCGCTGCAGCAACAGGCGTGTTCCACGGAAGTTTCCCACCCAAACTGGAACCAGCAGCTACCATCCATT
CAATCGAAGAAGGCCCCTCCTTAGCCAGTGAAGCAGCCTTAGCGAGGAGAGCACCATATGACTCCTTGAACTTCGGTGACACATTGCTCAGGACGTCAAC
CAACAAGTGTGAGTGGGCAGGAACAGTCTTGTGCGGACGTGGGTCGAACTTGGTGGCAGTCGAGCGGTTCACGAAGAAGCCGTTGACGTGCGACGTGATG
TGGTAGCGACTGTTGTCACCAGCGGCGACCACTTCCAAGTACAGCAGGTCGCCCGCCAGCTTGCGCGGTCCTGGGGGTGGATTGTAGCCCGAGAACACGA
TGCTCTGAACACAGGCAGGGAGTTTGGCGATTGGCTGCTGCTCCTGTTCCTTCTGGTTGGTTTCGTTTTGCTGCTGCTGCTTTTGCTTGTGTTGGTTCTT
TTTCCCTTTCTTCCCTTTCTTGATTTTAGCAGGCGTATCCGTTTGCTCCGACTCCTCCTTCACGGCGGTGGTGGCACCAGGGAAGGAGTAAAATTCCGAG
AGCTCGGGTTTAACGGGAATCTCGATGCCCTCAAGCTTGTGGTGGATTTCACGCAGACGCTTGAGTTGTTGTTCTGAAATCTCCTTGAGCTTCTGTTCGT
CAATTTCCTTGCTGTCGGCAGGCTCCTCGACCTTGTCGGCAGTCTCCGGCTGGGTCTCGAGCTCTACGGCGGCCTGGGGAATAGGTGGGTTGCTTAGCAC
GTCACGGAAGCGACGCACCTGGGCGCGCGCCTTGCGGGCGTCGTACTTGTCCAGCATCATGCGCAACGTGACACCATCCGTCACATTCTCGTATTCGCTG
AGCTCCACGAAGTCATTGAGCGGCTCCCAGGTGTCGTCCGTAAGGCGCTTGGCTTCCAAGTGGTAGCACGTGTAGCATGCTAGCGCTGGGAACTCGCCAA
TAAGCTGGCGTAGCGCCAAGACAGTGTCCGAGGGGCTCACGCTCTCCAAACGCAAGGGTTGGCCTGTTTTACCGGCGGGAGGTGCTACGAGCACGCTAAA
AGACGATTCGTCCACCTCCACAGCTTCTTCCTGCTGCTGCATCGGCTCGATGGTGTCGCTACTGCCCATGCTGAGAACGGAAATCTTGCTGCTGCTGCTA
GCTGTGCAAAAATGCAAGTGCGTTGCAATGTGTGGTGCGAGCCTGTCGTACCGGAATGCGAGTACAGAGGATTGGAATTACATGTTTTATGGTTTAGACC
TAGGATTTACAAGAAGTGTTTGAAATCCTTCTTAAGTGCATATACATGTTCGCTAATGGTTCATTCATGCTTGAAGTATAATATTACGCATTGAAAAACG
GGTCAGATTTAAATATGCCAGTAATTCGCCGATCCATCGTGGCGGCTGGTTCTTCACTGTCACGCCGCCCGCTTGCCTCCTTTGCACTCCGTACCATGAG
CTGCGATGAACGTGCTAAGTCTGACGCCGCGGCCTCGTCGGGTGCTGCCTCCACCGCGGGCGATACCATCTTTGACAAGATCATTAACGGGCAAATCCCC
ACCAAGATTGCGTATGAGGACGAGCAGTGCCTCGCATTTCACGACGTGAACCCGCAAGCGCCCGTGCACATTCTGCTTATCCCCAAGAAGCGCGACGGAC
TTACGCAGCTCGCGCACGCCGAGGAGCGCCACGAATCCATCCTGGGCCATCTGCTCTACACTGCCAAACAGGTCGCTAACCAGCAGAACTTAGACAAGGG
TTTCCGTATCGTTATTAACGATGGGGCGGACGGCTGCCAGTCGGTATTCCACCTACATTTGCACCTTCTTGGAGGGCGCAAGTTGGGCTGGCCCCCTGGG
TAATGGAGAGGCGAGCGTGTCGTGCTCGTGATGAAAAAGGGGGGAGAACGAGCATAATGAACTGCGGAGGCAATCGAGTATGTTTGTAGGGAAGAAGCAA
AAATGATCTTCAAGGTGATGCATCGCTTTCTATAGCTCTCCGGATTGTCTTCTCTAACACAGTAGATCTAGCCTCGGCCACAAATCTCTTTGTGGAACTG
GTCCAGGAATGTTTCCATGAAGGCATGGCGCTCTTCCGCCAGACGTTTTCCTGCATTGGTCTTCATCATGCCACGGAGCTTCAGTAATTTCTGCACGGAG
CGGAGCACACTAAGGTCAAAGCCTAAACGTTATCAGCAGTTACAGATAAATTGCGTACCTCGTAGAAATGGTTGATAGTGGTGTTGGGGCGATTCTGGTC
CATGTACTGCTCTTTGGTCATGCCGTCGACCGGGCACACATCCGGGTCATAAAGTGGCCGCAGTTTGTGTCCTCCATACGTGAAACAACGTGCAATTCCG
ATGGCTCCAATCGCATCCTATACAAACAATGGCTCTCATGCGTCACAAACCTGAATCTCAGGGCATTCGTGACAGACAACGAACCAGTCGATCGGCATCC
TGGACGCAGCCGTATTCAACAGAAAGCGAACGCTAGCGCGCCAAAATTCATTAATCTCAGCCAGCAATAATTGGTTCAACGACCTGGCGTACCGATTCCT
TGCCTTCTAGCTCATCTTTGAATCCCATGCTGTCAATAATGGTCATCACACGTTCGATCTTGTCTCCCGAGATGCACTCCGACTGCAGAAAACAAACTGC
CCTTTTCGTAGGCTTCTCCTTGCCTCCCTGATACTTCCAGTCGTCAATGTCATGGAGCAATGCTGCTAGATCCACAATCTCCAGATTTTCCTCAGACACG
CACTGAACACAATACTTCTCATTAGGTACAGCGCTGAGAATTAAGCACAAGCGACTTCGCGCCCACCTCCTCCTTCGCTAGAGCCCTCGCCAACGTCCAG
ACGCGCTCAATGTGGCGCCAGTCGTGCGACGCGTCGTTTGTCTTGAGCTGTTGCTCCACGAACGCCGCTGTACGCTGCACCAGTCGAGATGTAGCCATCT
GACTTATGGCCAGTCAAATTGCGCACTGCGGCTAATAAGTACTGCATAATAATAAACATGTTTTAATACATGCACTGTGTTGAAGCCAACAATACAATTT
GTAGTATCCAATGGATACCATGGTATTTTCTTTTACTAAAATACCCGCCAACTCAAGTCGGGTTGTCTTCTGTTGGCGCCAAACCCATTCTCATTACGGA
TTGGCCAATAAGCGGTCAATAACTTCAACGTCATTTGAAACTCCTGCTACGGCTCAGTCCCTCACAAACAGGCAAGCCATGAGCAGCTCCCGCACGAGCT
CCAGTCGTGGTCCAAGTCGTGGGAACAAGAGCGAGAAGCCTCGCAAAATTACAGCCAAGGCGGATGAGCTGGACGCCTACATGGAGAAACTTTACGATGA
CGATGTCGAGTCCAAGCTGCAGGGCGCCAAGATGATCCTTGAACTGGCAGAGTATGCAGGCAACATTGAAGTCCTCGTGCAGAATGAATCACTCATGGTC
GGTAGAGATCTGAGTAGGTATTCTCGTAGTCGCACACAACAGGTTCACTAACCGGTGCTCGCTTTACACAGAGCCTGTTGTCGCGTGTTCTGAATGACGA
CTACAAGAAAAGCTACGACTTTTCGCTCATCATGATGCGTATCTTCTGGTGCTTCTCCAACTTCCTACAGTTACATGCGCTACTGGCTAACTACCGCATT
GGGGCTATCACACTGAAGATCGTCGAGTTTGAGCTTAAGCGTCACCAGCTACGTCTCGAAGAGGGAAAAATGCTTGAAGCCACCGCACATGAGGCCCCAA
CAGACGATACCGACTTTGCGCTAGCAAAGCTTGACCGTGAGAAGAAGCGCAACAAAAAGCGCATGAAAAAGCAAGACCAACTGTTGTGAGGAGACTGATC
TGGTGGCTGTGCAACCTGGTCGTTAAACTGATAGTTGACTTTTATCTGCAGCTGTGTGTGCTTCAGCGTGCTGCTGAACCTGGCAGAAGACATTCATACC
GAGCGCAAGATGGTCAAGCGCAAGATTGTGATTTTCCTGACTAAGGTACGTTAATTTTATTTTTCTGATAGCTCCAAGCACTTACCTTTTTTGGCTTTCG
ATCTTGGAAAAGTTGTTGGATCGTGTAGCACCCGATCTGGTAATTCTGACTATCACATTCCTCAAGAAGTTGAGCATTTTTGAGGAAAACAAGGACGCAA
TGATGGAGCTTTCAGTGGTGGAAAAGCTAGTGCGATACCTCAATTGTAACCACGACAAACCCATCCAGACATCACTCAAACTGCTGTTTAACTTGTCCTT
CGATCCAACGCTTCGCGAAGTGCTGGTGAGAAATAGTCTTATCCCGAAGCTGGTGGAGCTACTGAAGAAACCTCCTTTTCGAGCGCTTTCCCTACGAATC
CTTTACCACCTCAGCATCGACGATCGATGCAAGTCAATGTTCACATACACAGAGGCAGTCCCAATCGTCATGCAACTGGTAATTAATTTCCCACAGAATA
TCGTGGCGAAGGAGCTGGCTGCGCTGTCTGTGAACCTCAGCCACAACGCGCGCAATGCCGAACTCATGTGCCAGAACCGTGGTCTAGAAGCTCTTGCTTC
ACGTGTATTTCGCACTCGCGACCCGCTGCTGATGAAGGTGATTCGAAATATTGCACTGTGGTCGTACACGCTGCAGGAAGATTTGGTCAGCGACAAGGCG
TACAAGTATCGAGGCATGTGGGCCCCCTTCGTGGTCCCATTTATCGAGCTATGTCTTACTACTGACAACCACGACTTTTCTGTTGAAGTTGTAGCGACGC
TAGCAAACATGACGCCAAGTGATCTACCGTCGAAGGGTTCATGGGACAGATTGGTGACAGACCATTCTGTTATCCCGCTACTCAACAAACTCCTTGTACC
GGGCTTTTCACAAGATGACATGATTTTGGAAGTCGTACTGTTTGTTAGCACGCTCGCATTGGAACCAAAGTGTGCTCCTCTGCTGTCATCATCTCGACTT
GTGCGCACGCTGCACTCACTATTCCAAGAGAAACAGCACGACAACGAGCTCACCTTACAGATCCTTTATGCATTTTATCGCATGCTGAGGCACCCCGATA
CGTTTGAAGATATTCTCTTTGGTGTCGGCTTTGTGCCGGACTTGCTTCTCGCTGCTGATGCGCCGAATATTGAAGTGCGCCGGATGTGCGACGTTCTCAT
GGACTTGATTCTCGATCATGACCTCAACGACGGAGGGACCATCGGGGACCTTGGGCATCTCATTCGGCAGCGCCGGTTCGAAATTCATAATGCCGAATAC
CTCGAGATGATTCACGCTGAAACACACAGCGCAGTATTCCGCAGACACCACGGGATGGATGACAACAGCGGCAAGGAAGACAAGGACGGCGACGATCACT
AACTACAGTAGATTATTTCTTACTACTTTATAATCATGAAAAACAACGAGGCGGAGCGCTGTGAAATTTTTTTGGAAAGGTGATTTATTTTCCGAGCGGA
GGTAGTACTAAAACGTTATGTGTACGAGCCAAACCTAAAACAAAGAAAGTTAGACCAAACTGCTTCCTGAAATACTGCTGCTCACTCGACTTATCCGATT
TTCTTCTTCGTCAAGAAGCCTACCACACTCTTACGATCAATTCGCACGCGAGGCAGTGCTTTTTCCGGCCAGTAGTTGTTGTGTTCGCTATTGATAGACG
CTCCAGGTGGAATCACGTACATGTTGTACGGAGAGTCGGCTGCCATCTTCAGCGCGAGTGCTCGAGAGTTGTGCTTTCGCTTGTCCGAATAGCGGACGAG
CTGTCGCACAAACTTCCAGTGATCGTACGCGGATTCTAAGCAGAAAAATGCCATCGCCGATTCGTGAAGGTTGCGCACTTCAGTCTCCAGCTTTTCCATC
CCCACAGTTCCATCCTGCGTTGCCACGATGTTTTGGCTCGCTGGAAATTGGTCGGGTGTCATCCCGTCGCGCGTACGGCACCAGAAAGCATCGACCCGAA
ACTTGTGGAAACTGCTAGTATCGGACGCGTCTTGAATCTGAATAAGGCACGACCAACCAACGGCGTTCGTGATGATTGGCAGTTCGCTATCGATCGAGAC
CTTCTCATCTTCCCCGTCAGTTGTTGGCTTTGTATCAAGACCACAATCGATCAAATCAATCAAAAACTGAGCTGCCCTCCATTCAGCTAGGCGACGAGCA
TCCACTTCAGTATCCCACGTAGCCCGACAAAGCACATGGTCATCTACTCGTACGACGCAATGGACGCCAGAAGGTGAGCGAGAGTGTCGAGAAAATGACA
TGCGAGGCAGGTCTTCCACAGCAGTTATGATCTGGAATGAAGAAGAAAAAAAACAGTTAGTTTGAAGCTGTAGGAAAGAGCAGGTAGATTTCATTACTTA
CACTTGCGATGCCCGACAACATGAGGTCCCGGAAGGAATCAATTGGCGAAACATATGCAAGAGATTTCACGTCCAAAAAGTGAAGAAGTTGTGCCCAGAC
TGACCGAATCCTGTTGAGTTTGTTTAACATACCGTCAACAGCAGCATTGCAAGCATCAGACTTGGACACCTCCGATGCCTTGAAACGAATGACATCGTTG
ACATCAACAAGAACTTCATAAATGCCTTCCCGAAGACGTTCCATCCTAATATTCGCAGTGACATTGGGAACGATCCTTCTGTTTTCAGCTCCGCGATACT
TCAACGATGCCCGAAGTCGATTGATTCCAGCACAAAGCTCATCTGTAGGAGTAAAGAGACTGCGGATTGCAGCACGGAACTTGGCTTCATCAGAGAGATT
GCTCTCGGACCGTTCATCATAGTCTTTTTTCAGCTCGTTCTCGAAAGCTGTAGTCTGTTGTGATGCGATGTGTGCATCCTGTGCCGTTTTAACTCCAGAC
GGGTCCCAGTCATCATCATCATAGCCGTCCGAATCGTTATCGTAGTCATCGTCATCATCCATCTCATCGTCACTGCATAATATGAGATTGGTCTTCTTCG
CTGGGGTTGATGTCGTCGAAGCATTAGATCGGGCTGCTCCAGCTGCACGTGTCGTGTTCGAGCTTCCACTGGTGGAACGTGACGATGCTGGACTAGACTT
CATCTTGTTCAGAGATTCCAAAATGTCGCGCCATCTTTCATTGGCAGAACGCTTTGCATCTTTTGCGTTTAGGCATGCCGTCGAAATGGCAAGTGTGTCT
CGGACCTTAATAAAATACATGAATAGCGGTGGAACAAGTTTTTCCGATGCTGACACCTACGAAGTAGTAGAGGAAATACACCCCATTAGCGCTCAGCGTT
GTGTCACTAACGTATATATTGTCTTACCTTGTCGCGATTCTTCGCTTGAGTCTCGTTACCAGCCATCAATGATGTGGGGGTTTGTCTTAGCCGGTTATTA
TAGCTTGCCAGCAATGCCTTCCACGTCTTCACTATCCCATCCAATGTATTAATCAGAGTCCATGTCGCCTTATCCTTTGCAACTTCAATAGACGGTCCTT
CCCCACAAGCCTTAACCACATCTTCAGATGCACTGAGCACGCATCTAACAAAACCATTCTGCTGTGTCGCGGTACGCCAGATCTAAATAAATTATACCAC
ACACACGTTAAAATAACCACGCACGGGCCACGTGATTAGGTACAAGTGTTTACCGTGAAACTCGACGATAGCCGAATTTTTTCCGATCTGACACCCAGAT
CCCACACAATTGCTCTGATGGTTGCGATAACCTTTTCTCGATCTCGGAAGAGAAGCACTAAAAGCTCTTGATAGATATCCGACTTCGCCTTGGCGACTTC
ATCTTCGGAGCGGACAGGGGGGGCATCACGGGTAATATCTGATCCGCTTCGGTCCTCCATAAATAAGCTTGCTGGATTCGTTGCAGCACTGTCATTAACT
CGCTCAGTGTTTCTTTCCTCGCGTGGTGCATGCACTGGTGCTTGTGATTCTGGTGCTGCATACGATATGCGAGGACGAGGAGCACCACGCGCGTCTTCAT
AATACTCCTTTGCATGTGGGGCATAGCGCCGCTTCTTCAAAATACCCATAGACCTTAGCTCTGTGTCCCTGCTCTCCCCGTTTTCGGCGATTCGGGTGCT
CTCTTGTCTATCGGTCATCCCATCGTACCCATTTTCGTGTACACTGGCCATCTCATCGTCGTCATTGAGCTCATATGAGCTATCTTGGTGAGGCTGAGTC
CTTTCACTGGTAGCAGGTTCAGATTCACTCTTGATCTGTTCTGCGCCGCCCCGCATCAGGCTCTCCTCATATTGATCGATCAATTCCATCAGGAACGCCA
TAAGTGCGTCAACAACTTCGCTTTTCGTGCTTGGGAAAGATGACCCTCGCCTACAGATGAGAGGAAATTCTTGGATGTACGCCACTATATCATAAACACC
ATCGTCAGGATCCCGGCTAGGTTTTTCGTGAAACTGTAGATGGTAAGAGCACATAAGTTTCACGAAGTCGTAATCTATATGCCAAAATGACAATGAACGT
ACCCACACAATCTTCTTAGCGACGAGATAGTTGAAAGCCGCATCCTTCACCTTTCTGGTTTCATTATCTTTGCAAAATCCGAAGTGAGACTTCAAGTGCG
ACAGCATTTCACTGTACAACCTTTGGTGTTCCCTCACTGCCCTTATCAGCCTCGATAGTGCCCCGATTGTGGCATCCCGATCAAATGTACCTGAGCAATC
GAATGATAAATGCCCTAAACGGACGCGAGCGATGTACTGAGCCCCAACTTTCTTCAGCTCGCGCCGAAGCTGAATAGAATGTCATGTCAGTCATGTAGTA
ATAGTTATACATCATCCTAAAACACACCTTAAGTCCTGCCGCCAATGTAAAGTCCTTGCTCATCTTCAGCACTGGAACAGTTTGAGCAGCACTAGATAGC
TCTTCAATCGATGACACAATGTCAACATTAGGACAGACCAAGGCCAGTAGATACGATCGGCCTTCGTCACAACCGAAGGTCCTGGGTTTGGCAGCAGTGT
CAATACCACTCAGTTGTCTCTCCTGATACTCGGGGGAAGGAGCCAGGGACGGCGTTGGAGCATTGGCACACGTAAAATTTTGCTTCGCTGCTCTAGTCTG
CTGAGGTGTAGCAATATCCATTGCAAATGTTACTCGTCTTTTCGCGAGGCGTGACTTCGATGGTTGCGAGTGTTTCGGACACAGTGTTAAAGCAGGTTTG
CTGTTGTAGCTCTCGTCTTCAGGTCGTCCTGGTAGCATATCGACCGTCATGTCTTCAACGGCCTGTTCCAGCCCCTCCGCATCGGCCATGACGATATCCT
TTTCCACAGAAACTAAATGTTCAGCTTCTTCGGCCGTGATCGCATCATACCAATGCAGAAACTTGTCGGTAAGCTGGAAGGTCCTATCCGCTATCAAGGT
CTTTCGCGTGTCTCCAGTGAAAGTCTTGACGTACATCAGCATTTTTTTTGCTGAGTGCAGTCGTTGCACTGCCATTCGATCCTGCTGAATCATCGCATCA
TAACGTTTTACTAGCTGCTGGTGATGTATCAGTATCTCATCTAGAGCACGTAGCATGCGTCCTGGAGTGCGTCCCTGTCTCGGATCGGGCTGCACCGACA
TCCCCATGCGTATAAAGCGCAGCACCACCGTCCTTTTGGCAGATCTGTCCTGATCGTACTTGACCCTGATCTCTGCTCCCACTGCTGCTACGTCCTTATG
CAGCTGCTTGAGTTTTCTGGGACAGAGGAGGAAATCTTGTACGTCCATGCCGACTAAAAAATCATCCGATTCGATTGTGTAAATGGGATCAGTGTATCCA
TCAGCCAGTTCATCAATAAATTCCATCGGATACCGGGGCGCCTCAGTCTTCTGTACGCGAAACACGTGAGAGTCCATGAGAGCAGACACCGAGAGGCCAA
AATGCGTGGCCAATGCCAGGTTCGTGACGGGGCTGCGAGGCAGCGAATAGTGGACCTCGTACGCATGGCCTAGCGACAGCAGCTTCCGCGTGGCGAGAGC
GACCTCCATGCGCCACAGACGCACGCCCATGTCAAAGGCCAGGGCCTTGTTGGTCTCGGGTAG