Description :
From Genome Similarity Track
Location :
scaffold_29:11040- 17286
Transcript NameFunction/comments
Plaha_PHALS_15073hypothetical protein

Sequence
6246 bases(100 bases per row)
TAATGTACGTTATGCATCGCACAGCGCGAGACTGACAGTCCCTTTGTCCAACATGTCTTTCTTTTTAAAAGTCCCATCGCCTTCATCACAATTGAATTTT
ATTGTGGACATTCACCTTGATActttggtatttttttaagtCCAAGACCACTGGTGTTTTTGTATCATATAGAATCGCACCATCCCACTTATAATGAATG
CAAGCTCTTTTTTAATTACAATCACTTTCTTTTGATAAATGCTCAAAATCGAGGGCTCTATGAGCACAGATTGTGCTGTGATCTGTCTTTTATTGTTGAG
CTTAACAGTGTGAGCGTAAAAACATcttccattcttgcgcttgtGTATGACCCAACAGTTTCTCGACAAAAGATCAGCCCCGGTGGCCGACGACCTATGA
GCCAGATTCAGTGAGGCAGTCGATCTCAACTGAAACGGTCACATTGACTGTATGAGCTTCTACCAGCATCTCAACCTTCTCCAAGAGCCGTCTGAGATCA
CTGTTCCCCATTCACGAGAACCTACTCAAGGGTGAAGCAATTTTAAAGATCGGCCACGAGTTGCGCATTTTATTCCCACTCCTCACTGCAATTAATGTTA
ATACATGCGACGGCGGAGCTCACGACGAGCTCGAACACGTATCAGTACGCTGGATTGGCTCTGCAAGGATTTATTGCACTATTGAAAGTGATGTCTGGTA
AAGTAGCTTCAGACCAAACCACGTCATGATTAGCAATTTTATCTATCAGAAATTGCGCGCTGCGCCGTTGCGGGGCCTATACTGGTCTTGCACTCAAATC
GAGACTGGAAAACGTTTGAGAAATCGGATTGAGATGGCTTTTCGACCTTTGATAGCACCAAAATACAGAAGCACTGCCTGTGCAAAGGCAACAGTCGTTG
GGAAAATCTTCACGCTCTTTACGCAACGTACACCTAGTAGTGCGCGCTCGCACAGCTTCCAAAGGGCATCTTATTTAATCTGCACCATAAGGGAATAAGA
CTCGTCGAGTCGCCTGTTAAATGATTTTGCAAGCAGCTACAGTGAATCAGAAGCTCAATTAGAGCATCGTTTAATGTTCGACTTCATGAAGTTCAAAGCA
CAGTGTATTTTGCCATGTGAACTCTTATTAACGTTAGTATTTCTTATATTCGTGTTTATCTTTATGAGCCTGCTTATACAGTTTTATATCTAATTTTGTA
AAAAAGATGGGTTCCACTTATCAGCGGGAAGCGCGTTGTGCTGTGCGACCTTACCTCATCCTTCTGGAAAGAGAATGCGCCAAGTCATGAGCGGAGCCTG
CACcagagcaatcttgccgtAGTAAAACGCAAAGCTTCATGGTTTCTCGGTGGAAGGATATTCTTCCCGCTTCGCCAATCATTAAATACGGCTCTAAAGA
TTGTGCCAACTCACCATCCTCTTCATGCAACGTAAACCGTCTTTTACTCAACAAGCGGAGCCAATAGAGAGCAATACTCCCGGTGTAAGGGTATTCCTCC
CGCTCGCCAACCATTAAGTATGTCTCTAATAAATGTGCCAGCTCACTATCCTCTCCATGCAAACGTGAAACATCCTTTACTGAACTTGCTCCCGTGGTTG
GAACTTTTTGACCTTTTTGAATCATGGCGGTACGTTGACTCTGTCTCATAGTCTTGAGGGGCGGCAGAAACCGACGCGAGACATGTGATCTTTGAACGGT
GCAATCGTATTGGTCGGCTTAGAATATGCTATGTGGTTCGAAATCAAATTGCTCCTCTAGAGGATAGCGTAGCTCGGTCGAAGAGGTTACCTGAAGAAGC
TTCTTCATTTCCGATAAAAATGAGGACATGGCTTGACAAGCTCACGCGAAACACAGGGTTTGTTTGCATATGCTCTGTGATATTGAATGTATAGCTTAAT
CGACCGTAAGCAGTCCAGTGAAGCTAGACAGCAACTGAGTTTGATAGACGGCAGACACTGCATAATGTGGAAGGCTGCCcgcatttgataaaaattgATC
TCCAAATAATTCATTTTGGCCCTCTGCTTCGGCATAACATCCTGTCCGACAGCCAAAACATCGCCATCTGGGTCCATTACGCTTTCTCCCATGAATAAAA
CATAGTTTTGTTACGAAGTGTATACAGGCAGAATCAACAAATTAAAGTCCACTTCCCCACTAAGACCCGAACAAATTTGTAGTCGGTCACAGGGACAAGG
GGGTTAACGGGTTTATCAAAACAATTAGAAAATGCTAAGCATTTTTGAAGGCGTTATTAAATCTAATGCAAATTCAACGAGCGGGAGCATTTCGATACAG
AAATTCGGTAAGGCTCCGCGCAAGTGCTTTGATCCCCCACTTCGTGATTAAGGCATTTCGTCTGATCTCGGAAGCGCGGATATAGATGTATAACATTTGG
TGAGCTGTTGTGAGAAAAAAACTTTGGTATGAAGATGCTTGGCTGTATCTTTACTAATAACGGTGTCGCCGATAACAGCAAGATAAAGCATTTTACTCAT
TCAATCCACAAAAACCACGATGCCTTTACTTCTAGGGATGCATTTCTAGAAAATAAAACCGAAGTCGCTGCCGATTAACTGCCAACGTTCTTCTGAGGGA
CGAAGAGCGTGGACACATGCGGAAAAAGTTCAGACACCATACACGTTTCGCACGTGAGTTCCTACCCATCAATCCATATAGAGACACCAGGGCCTAGCAG
TTGTCGTATGTATTTTCTCAACTGAGGTGGCCATTCAAGGAAATACGTGTAACTCGTACAATAAATATGCTGAGCTTGTAGTACTCGTTTTTTGAGATAC
CACGACATGGGGTAGCGAGAGGGTCAatgctgtaatacagcaGTCCTTGGGACAAAAAAGCGGTGCAATCATACAactaattaggcggcttctTAGTGTT
TCTCAAAGCTTTAAGGGACGCGACAGACGCCACTTCTAAAACGAACGATGTGCGTTCCGCATCATCAATGCGCTTCATCACCATCGTGCCATGCGGTAGA
TCATAGTTAGGGCAGCGCAAGAGCGAAAACACCACTATATCTGGTTTGTAACTTACCTTGAACAAGTAAATGAAACCTTATCATCATTCTCTGTGAGAGA
TGATGTTACGACTTTGCTGTACGCAAGGTTGTAGATCTGAGCTCGCAAATGGATAAAGGCCAAGCATATATATTCTTGAATTTGACAGGAGCATAATACA
AAGCTAGATTCTCTAAGTCATGGAATAGACAGGTCCTCTTAGTAGCATTTACCGTCGACGCTCGACTAAAGTGGCAAATTCATGCCTATTCGCATCTTTG
TGTGATGCACAAACTGTGTGATAGGCTGAAGATTTATTTGCAGTCCTAGACCTCTTTTTCGCTGCTGCACTCTAGCACTCGTTTTCAGTGCATTTGTGAG
AAGCCCTGTTAGTTTGTGCTGtacatgtgcaagtagttggtcaGGTAAAACAACTTTTTGAAGTCCCTTTGGGAAAAATGGCGACGATCAGTCTACAATA
AACTGATTTTAATACAGTCTGAAAGTGTTGGCACCAAAGACACCGTTGTCTATATAGGCAAGCGTTTGATATATGCAATGCTCTCAAACACTGCGGCATC
CTAGTGTGAGGAGAAGATCCGTGCTAGGTGTAACCGTGCAGTAGCGTTGGAGCTATTGTCGCGAAAGCTTATTTCGGTAAGCGTGCTTTACAAAACTATG
GTTTAAGATACGTCAAGATAGGACTGTCCGTAGTGCAATGCGGTGTATACAATTATGTCGCCAGGCGGTTGCTGCCGCCATTACATTAAACAGTCATTCG
TGTTTGATGACTCCCTTTTacagcatcccgctcggtgAACATATCGCGCCCGCAATCTCTCAAAAGCAATTAATAACCAGGTCAACCCCGTCAAGGTGCA
GGTCAAATTCTTGTATACGAACTATGAGTGCCATAAGCAcctggccagaatggaaagcGCGAATTATATGATGACATTTACAAAATACGTGTGCATACGT
GATGGTGATGATAAACTATCTCGTTTTAATCACATGCATGCTCGTAATCCATACATGAGATAATAGGGAATGGCATGGCTTGGCGGTCCCTTTAGTAACA
GCTATTGAATCGCTACGGGTTCGTTTCCAGTGTGTCCAAGGAAATTAACACTAGTTGTGCTGACTTAGACATGCCGAGGTATGAATAGTCTATAGACACA
ACAAAAGGGTAGCGTACCTGCGCACAAATTGAGAATTCGCGAGGTGGTTGGTAGATTCTACCCAGGAAAACCCACTCATATCAATAGGAATGGAGCGCTG
AAATTAAGTCCATGCATGCGTGGCTGTACCAATTTCCTTGGTGCGCCACGTGTTTCCAAACTTTAGGATGCCCAAGATCAATCTAATTGTACACAAACTT
GTTTAGGTACTTATCGTTCTGTCATTGCATGTACCACCAAAACCGTGTTGTTTTCATCGCTCTCTCTAAAAAACATCTGTTACGATCTCTCAATACAGAT
GCCGACCATGAGGTGGTAGAGACGTCTATACATCCTGTGATCAATTAGCCTAGTTCCGCTCAGAGAAGGAAACCTTGGGTAAAAGCAATTATTCTGGTCG
AAAGAATGCTGTGCTCGGTCACCGATAAAGAAATTTAAGGGTCATTCACGCAGAACACGACTGCTGACAAAGGTGTTTAAGACACTTTTTGTGTTGGTAG
CATAGTTCCACACAAGTATCCAAGCCAAAAGTATGCGACGACAGGTCACCCAAACAAGTAGCTTGCTGTTTGCACTCTCTGTGTCACACCTTGTGTACCG
CAACTCTGAAATTGGAGAACACAGGACGTGACTATAACAGATTGCGTCAAACTCGAATAAATAAACTTTATGAACGTCATCGTGGTTCTGACTTCTCGGA
TGCCCAAATACAACCAACATTAAAAGAGATATCGAACCTCGAAAGAGTTTACTTTACGGTTCAAGTCTATCCAAAGGCCGGTGTCAATTTCTCGAAAGCA
ACATCACTTTTGAAGACTTGAACAGTGTCCTCCGTTTGGATATAGTTAAGGCTTACAAACGCAGCAAAAGACGGGCCTGCGTGCTCAAGTTTTCAAAAGA
TCcaaaagatgaaaagaatACAGACGTGGTGTGGTGTCAGCTTAATTCGCACCGGGTAGGAGATCTGGGTGTGACCCGAGGCAATGAAAGAGACACTTGA
CCTAAATAGTGCCACTGATCGTCACAGCAACATATTGCATGTTCAGATACACGATGAAGAGTGCACAATAATTTTTGCAGAAATTCGCATGAACTGCAAC
ACAAGCCGCTAAGCTGTAGGTTGACCTCCTTTAAACTAATGCTTCTTGTTTGATGGACCGATGATAAGGAGGACAGCGTAGTCAACTAGCCACTTGTCCC
GGTTGGCCATAGTTTCAACAGTCATTGCACTCTTTATTAAAAATATCGAAATAGAAGTGATAAAAGAATGGCTTTACACGAAGAAACAGAACGAGAGAGT
TCATAGAAAAACATTTGAAATCGCTTCACTGCGCAACTTTTCTCGTTTATTCCTTCTGTTCATTCGAATGTTGACATAGGCACTAGAATATTCAACGCCC
TTGGTGCCTCATTGTTAAATGTGATATACACGATCTATCTATTGGAGTCAAAATGTTCCAGGTTGTGAGTTTTTGTTTCGTAACACGTTGCAGAGCCACA
TATATTGATGGTGACCTGATAATTAAAAGCAAACCAGCTATTGCAATCTTAACAATCGTTGTGCTAGAAATGGTAATCTACATCACTTTCTGGACTATAT
TGTCACGTTGTTGTCGCGGCTTTTCAGGACATCTGTTGTTGTTATTTGAATTCACATTAGCTCCAGAAATTTTAGCGCTCCTAGGGTGTGCCTCCGAATT
ATTGCTGAAATTCAGCTAGAGTCAATGTCGTTTAGTTCCTTGCAGACCTTCTTGATCATCGCCACTTCCAACGCCTTCATAACACGCTTTCTATTTGACT
GCAATATGATTTCCATGGGGTGCTAAAAGTTGTCGCCATATGACACTGGATTCACTGCATCACAacaatttcttgactttttaCTGAGCTTGTTCATGTC
TGCGTGCTCTTTGATATCGAGTCAAGTATATATCGAAGAGTAACCGCAGGCATGTGTGTACATTGAAATATCACGTTGATGAAAGTAATTCCTGTCATTT
CGACCAACAGTGTAGTAACTCACTGACGGATGAAATGAAGTTGTGC