Description :
From Genome Similarity Track
Location :
Scaffold_844:11040- 12751
Transcript NameFunction/comments
Phypl_g11262hypothetical protein

Sequence
1711 bases(100 bases per row)
TTCTGTCAGCCGAGATCCTCCCAGGGCTCCGCCGATCTGCGGATCTTGTTTCATTcagcggcatcttcgtcgaTTCGATATCCGATGGCGCTTGATCCCC
TTGTTCTTTCTTCACTtgcgcatcttcttctgggAAATCACGGTGAAATCCTGAGTCACCAAGAgatccgggcacgcgcacAATTGTGGTGTAGCGGGAT
CGGCCAAAACCGCGTTAAGGCCAGATAGAGCTTCCCAACAgcgcccagacaccgactaacggagggggtcTCCCGATGTTCTGTGGTCTGCTGAACTTGT
TCTCACCTTGTGCACCCGTAGGTGGGCCTGATCTGCTCTCTGGGGACTCCGAAGGATGTAGTGGTGAAGCGTAGAATGTCTTGCGTGACACGGGAAgggg
tggagcagcgcggaagtcttcgctctgcgtcCGAGTAGTTGTTCCTGATCCGGAGTGAAtcgagcgagcgagctccGATCTGGAAGCCTGGACTTGATCC
GAGGCCGGGTTGCCTTTAAGGGTATGAGCCTTCCTTTCCGTGagttgcttgctgcttcctATAGCNAGTTGAGAGTCGAAGCGATCGCCGGTCAAGCAAT
GAATACCGGTCGATCGAGATGCGTTGTTGAACAGTAGATCACTGGTGTGTGGAAGGATATATCGACTCCATTCTTCTTGGCAACAAGCACAATCGGCAAA
GCCAACGCAGATTCTGAGTGCTCGATCAGGCCCGTTTCCAGGCGTTTCTTGATCAGCTCGTATACTTTAACCAGCAAATGCGGGACAACCTGCCTTGCGC
GCTAAGCCCCTGGACGCACATCTCTCACGTCCAAGTCGCAAACCATACCACGAGCAGGGGCTGGAGTCGCGTTTCCATTGCCTAAGAAGATTCTGCGATG
ATACTTCAAAATCTTCGTCAGCTAGGAGTCCATTTCTGGAGTCGAGTCACCATGAACACCAACATCAGCCTCCTCAATTCTGCAGTCAGGACTGAGATAT
TGAATCTCAGGAAGCATTCCGAGCTGGTCGCGCAGCTGATCCATCAAGTCACTTCCTTCACGGATATATACCGGCGGTTCTAagtccagctcttccactG
AGACCCGCAGGCACCTCAGGTTCTCCTCTTCCAGTTTCCGCATAGGCGTACTAGCGAACCCTTGGACAGGCAGGTCTGAGTCCAAATCTCCCTCGGAGTC
TGCGTTCATGGATTGACCTTGACCGCAGATTTCTGGAAACCTGATTTCAGAGTCCACATCAAGTAGCACTTGCAGCGCCGTCCGAATCTGCAGCGTCAAT
ACTAGGACTTCCGGCAGCGATCTTACTCTCCTGGTCAGGATCAGTTTGTACAGCAACGTCTCTCAGCCTTGGAATGATTCTGTTCTTCTGCTCAGGCTCC
CGCTCTTCCGCAAAACTCACTCGAAGGGTCTTCGGTTTTTTGTTCCCCTGAACCATCCGAACTTGCGCGGTACCGGGAGTTGGTCGTAGCAAAATCTTCG
ACGGTCAGGGATAACTTTGATTCTGAACGCAAGATGGTTCTTAATTGTACATCAACAGAGACAACTTGTCTGCTCTCATCTGAGCTTGAGCGGACAGTGT
GTTCTCATAGATGAGTTGTTGCCACTCCTGGTACTGCATCCTTCCTGGACGCACATAGCGGCCAGCTCGAGGAACGAATCCATACTCAACGATTCTGGCC
AACGCAGTGTG