Description :
From Genome Similarity Track
Location :
Scaffold_296:11039- 19262
Transcript NameFunction/comments
Phyke_g7965conserved hypothetical protein
Phyke_g7966hypothetical protein
Phyke_g7967hypothetical protein PHYSODRAFT_513915
Phyke_g7968hypothetical protein PHYSODRAFT_354953

Sequence
8223 bases(100 bases per row)
TGAACAAAACAGTCGCGGCATCGATATGAAGCGATCGCACGAAGCTCGGGGCATGCAGATACAGAAACTTGCTGACCGCACGGCAGCGGAGCACATCTCG
CCCTcccaagaagctgcacacgTGATGCAGCAAATCCAAATTGCTGTTGAGCACGCAGCCTTTTGCACCGACGCTGCAGTTGCGAATATCCTGTTCTGTG
ACGATCACTCGCGGTTTCAGTCTCTTTGCAGCACTGGCTCGGATGGCGTCCAAAACGTCGTCGCTTGGGTCAGTCTCTGATCGTTTGCGCTTGTAGTGGG
TCACCAGTGCCTGCACTCGCCGTTCCAGAGACGGTTGGTGTAGGTACTCGCTCAACGATCCCGCGGAGTGGTACAACATCCACTCGAGTCGCTGTAACAG
CGACGGCCTCGTGCCGGTGTCCTCTCGAACCTGCAGAATTGGGTGGTGCTGGGCTAGTGCCGGATGGTTCCGAAGTCTGGCGATCATGATTTTCCGGACC
TGCACGTCAGTGGCATCGTGCCACGCTGGACTCGTGTCGAGCGCTGCAGCCTCTGAATTCGTGGTGACCATGGAGGTTGCAATCGTGTAATTGAGTGTAA
ATTCGACAAGAAGTTTTTGTTGCTTTAGTGATAGTCGACCAATTGAGAAATGGAGACTGAGGAGCGTTTGGGAGCGGGCCTCTGTAGATGATGCAGTGAT
AAAATGTTGACTGCTAAAATACGGACCGAGCAAAAAAAGAAAACAGATGAAAAATGCGATTAGTCCATTTGCTTCGACTGTTGGGAATTATTGTAGAGAT
CCAGAGTTCGGTTGGACAGCAGTGATTCTGAAGAAGACTAAGTCAACAGGTTGGTTTATCCAAGCAGCATCGGCAAACCAGGAGTCAAGTATTGTGCTGT
ATCAGACAGTAATGGCTTCACACAATTTTCCtcatcgtggtggtgggatGGTTCTACGAGGAGTTTGTTGCAACCCATGGCGTTTCACATGAATTTGGCT
TCGGCAAGAGGCGGTGGATGGCTCCGGAGCCATTACGTTAGGAGATACTACAACAACTTTGGTCGCGAATAGTTCCAGTAAAAATTTAGCCATTTGTTGA
GCGACCCGAAAATCCGAGACGAAACCCACTCTTTCCGAAAATATATTTCGAATTGCACCAAGATATCTGCCAAGTCTCCTGGACAGTGTCCAGTGGACAC
ATACTGGCTACCAGTCTGGTAGTCCGCTTGGTCAGCAACGATGAGTGAGTTATCGCCTGACGGAGGGGGGGAAATACAGAGACCACCATACAACAGGACT
CCCGCTGGAGCTTTTGGACCGAAGTAGAGAGATATTTTCATTGACGTGCTGAACAAGAGCGCGTATACACTCTTCAGTGCTTATGCCCACAGGGCAGCGC
GTGCATCGAAGACTGCCAAACCCGGCTTGGTTCCAACCAGGAATTCAGAAAAACGTGAGTGACAGATGTCGTGCTCGCCACTGTCAAATCCCAAGGATCG
AGAAGATGTCTCTGCCAGCGACTCTGGGTGCGCTCGCTCCACTGGTTTGTTGCGACGAAGAGGTAGCGTGGTGGTCCTACTCCAAGTGCTTGTGATACGA
AATACTGACCTAGGTTGCACCCCGCAGCGGAATTCGCTAATCGGTTGGACAGAAGCGTTGATGTGGAAGTTGTGCTTGTCGAAGCGCCGGAACGCGACTT
TGTGCCAGAAGTTCGACTACTGGATTTTACCTCTATAAATTATTTTACCTCGAGCCAGTGAAAAGATACCCACGTCAATGCTGTTTAACAAACCTCTATC
AAACCATATATGAAGATAATTAATAATTTGTTGGGCATAAACGATAACAGTACCAAAGTAGTCGCAATCACAAATGTTTATGCAGCACGAGAGGTCACAG
CAAGAAACGGTTTTCATGTCCTGTTCGCCTGCTTTCGGCGTCGGACTACACGTTATACCTTATAGCAATGGGTGTTAAGACAATGCTGTCCGTGTATTGA
GCGCAGCAGAGAGCGCCTCGAGACCTTCGTGGGAGATAAAGTTGtcctgcaccagcagcgtaCGCAACTGAACACGTGGTATCATCCCTTTTAAGTTGGC
CTCCTGCTGACAGCTCGGTTGTCGAAACGTAGGCTGCATCGAGGAATTGCAGACACCACCTCTACCTGAAGGAATAATCCATTCGGCTAGAGCGATTGCG
TCAAGGTCGGTAAGGATGTTCCCTCTCAGGTCCAACACACGAAGCGATGGCAAGCAACGCAACATGCGAAGCAACGCCCGACATCCACCTTCACCAATGA
AGTTGCTCCTGAGAACCAGTACTTCCAGCGACGCGAAACAGTTCGCTTCTTTGGCATCTGCGGCCAATTCGAAAACGTCCGCCAGCCGATTCAGACGCGA
GTCACCTAAATAGGTTGAATCGAGGCTCAACTGCTTGAAAGACCCGACTGCGTCCACTCCACTTCGTGTCTGACTGAGATTTTGTCTCCTTGTACAAAAG
GCCTGCAAGCACTTCAGCACATCGTCGCTCTCCGCGAAATAGTCAAGTGGTGACCCAAGATTTAATTCTTGGAGCTCTGGACATGCACCGATATCGAAAG
CACGTGCAATGTCACGTAGCAGGAGCTCTGCAACGAATTCGGGTTTTGATGTGCCGTCTCGATGTAATGCGCGACTGAATGAGGGTCGACGATGAACTTT
CGTAGATGTCGGTATTTCGGTATTGACGGCGCATAAGCACGACTCGTTTGCATTGCTGGTGACCACGAGGCTCGTaagtttgctgcagctgagcagTAAC
GAAGTCAGTGCACCACTCGAGAAATATCGAAGCGCAGATGAGTGCGTCTCGAGATACAAGGTACTCACCATCTTGGGTGCATTTTCAAGCATGAATCGAT
TCACTGAGCGCAAACTTAGCACGGTGCGACCGGATAGGAAGCTGAGCATGAGACCTATAAGGTTGGCATCGTTGCCCAGCAGAAATTCGCTTCTGCTGGC
ACTTTTGCAATCACTCAACAgcgtctcttcctccatACATCGACGTTTCTTGGTAGGGCCATTGTCGACTTTTGCGTTGTTGTCCATGCTTTCTCGATCA
CGTTTGCCGCCACTAGTAGTTTCCATGCGTGTCTGCACTGTAACCGTCTTGGGTTCCAATTGCGTGACAAGTGCTTGCACACGGCGTTCAAGTGACTGCT
CGTGTATGTACTCGTGCATCGAATGGGCAGCGTTGTAGAGCATCCATTCCAACCGCTGCACCAGTGACGGCACCATGGCATTTTCACTGGCCGAGCACGT
CGTCCCCGCGAGCACTGGATGAAGTCGTCGCAACCGCAGCATCATGAGTTTGCGCGTCAATCGGTCGTCAACATTGTTGTGCCACGACTGTCCCCTGGGT
GGCAATCGAGACAGTACCCGAATGGAATCTGAAGCACTTGGACCGGGAGTCGACACTGTGGtctttgacgacgacgaaggcgTTGACGGTTGCAGCAACA
TTCAGTGTCCGGGTTTTCGACGCGACTTCGCCACCGCGTGTACAATTTGAAAATGGATGGGAATGCTCGCCTCGTTCTTCAAGGGTAGCGCTATGAATGA
GGCCAGCGGCTATACATATAGCTGATGACGTGCACAGGAAAGGCGTGGAACCCTAGAATAACAAATCCATCGATGCTTTGAATTCATTTTGAAGTGCAAT
CAAATGGCACTTGCGGTTTCAGTAGCTTGCGAAATCTCGAACTGATCATGGTCAGCGGAAATCTGGGGTCTTTAAGCCTACTTTGATTATTACGATTTAC
TGAAatttggagctgcatgaGCTTTGATGGTAAAACCGAACGACTCTTGCCAAAGAATCGTTCATTGCTCAAAATCAGTTGAAGGCTATTGACACATGTG
AAGGTAGAAACCACATGGCAATGGCTGGATCCGAGTTAGAACGCGTACAACGTCATTACCGAGGAAAATCACACATGAGTTTCGTCACATAAGTGGCATA
GTCGCATGGAGGTTCACGAGAGAGCATGGGTACTTGCAGTCGAACACCCAACTGCAAGGGTTTTCTGGGCATAACACGTCATAAGCACGGTGGATCAGCA
TAATTCGTTCTGTGATAGGGGTCCGTTGGGAACAGTTTGCAGACCCTATACAAGTAAAACTGCAACCACTTCGCATGTATCTTCTTGAAAGTCATTTCAT
AGATCGCTCTGGACTTGTACTTTAACGGGCATGGCTTCATATATCAACCCCATTTTAAATGATTGGACACGAGCTCGTGTCATTACTGTGCATACGAGAT
AAATCTATTCATCCACACGATGCAGAggcaacaaacagcaaaattTGATTCAACCAGACTATCGTAGTGGGGACGCTGAATACAGTGTAATATATCGGAT
GTGCTACCATATCTTACGTAGACTCCATGGATACATTTTACCGAGTACTATGCCGTGGTAGGCTTTGCAGCCAGTGAAAATGTAgctgtgctgcatcttc
gaAGTGAGGATTTGCCACCATCATTTTGCATTGGGTTCACCGGCTTGATTCATGCACTCGAAAATGTCTGCGTCTGTCAGAAACAGTCTTCTACTACGTT
CAACATCCTTTTCTGCATTAATTGTCTAGACCCTTAGCTCTCCCTTACGACCTAGCGCGCCTTATTTCCAAGTTCggcgctgcttcttggccggCGGAGG
TGACGCAAACTTGGCTAACCGCTGTAACCCAGATTTCTTAGCGTCCTTGCCAATTCCCTGGCTAGAGGGCGATGCAGACGAAGCAGGTTTCTTGAGGAAC
GGGTTCGCGGGTGCCACAGACGGCTCCATGCGTTTGCTTTTACCCTGGGTTATGGCAGGCTTAGGAGAACCTGGTACCGTGTCCTCTAGAGATTGACTAG
CGTCGGCAGATGCATCTTCCGACGGTTCCTCACGGGGTGGTGTTGAAGGCGGTGGTCGAGACAGAATGCTGCGTGCACGACGCAGAGGCTCCACTCCCCG
TGATTCAGAAATGGCCTCCTCTTGACTGCGCACACGATACGATGCCGGTTGCCGACGTGGCTGAGACGATGCTTGCGTCACCGCCTCTTGCTCAAGCCTC
TGAGGCTCCTCAAACTTGACGCGGTACAGCTCATACAGCTGAGATTGCAATTGGCGAAGTGAGAAGTGGATGGCAAGTTTCTGTGCAATTTGGTGAGACT
TTTCCAAGTGAAGACACTTCGCCAGGTCTAGCACGCGAGCAGGTTCGTCATTTGTACAGGcagtcttcatcatcaaaatcAAGGCCTTATCCATCTCGGC
CTGCTCCTGGACCACCTGGTTGCCCACATCGTCTTTGTTGGCTTCATTGGCGCTGGCCTCCAGTCCACAAATACGCACATTTTGCCACATCGTGCCGTTT
GACGCGTCCTCATTCTTCTTCGATGTCTTCGGGAATGACGCTGTTCGTAGTGGGAATGTGCCAGGCACAGGGCGGTGATTACCTCGCAACTTCGGAGCTC
TGGCACCCTTGTCTAGTGGGAAGTAGAGCAAGGAGCCGTTCACAACACCTAGAGTGAATACTCCATGACGGTCTTCAGgtttcttctgcagtgcattgCC
CACACAACCAATTGGGAACCAGTTCCACCCAATACTGGGTGACAGCGCTTGCACACATGAAAACGAGTCTACAGCGTAAAGAATCTCGCGATCATCGAAG
CCGAGCCAAGTGAGCGTTGACCACTTCGTTAAATCCTCACGCAACTGTTCGTTTTCCTTGTGGGACGCGAAAATATCTCTTGGGGGTGGCGTAATGGGCA
AATCTCCCTTCGAGACCAACACAACACGTTCGCGAGATGCATCCACTTGAATTCGGAGGAGCTGGTAGAGCATCTGCCCGTACAGACCCTGATACACAAC
GGCCAGCAAGGATTCCCTAGCTGTCATCGTCACGACACGGCCAGGTAGACGCAAGAGCGCGTAGTCGATGCCGCTGGAAGTGTAGATACGTAGAGTCTGC
AGCGaggtggcaacagcacagaATTCGCGGCCCGCAGCGACGCACTCGGCATCCTCTCCATCAGGCAACGTTTTGTGCCAAGAACTGTTGCTCGCCCAGG
ACTCGAACGGTCGATAGAACACAAAGCTGCTGATGACATCACTTTCGTCAGTACCAGCTTCGAGATCTTCCCAATCCTCACGAACGCGTCGTGGAACGGC
GAAGATAGCACCGTAGTCGTCCAGGAAAGCCATGGAGAACATGTAGTTATCGTTGAACTTAAAACCACGTCGAGACTTGTCTGTAAACTCCACCTTCACA
AGGTTCTCACTCATACTGGCGCCGCGGATCATTTCGATCTCACCCCGAGGTGTCCACGCTAACAACGACGTTACATTACTGCTACGGCCAGTGGGATCCA
CTACGCTGCCGGGTTGGAAGGGCTCTGTCACAGTGCGCAGAGCAGCAATGTTATGGTATTTGGTAGGCGTACTTGGGCGAGCAGATACAGTTATGCCCTC
ATCTTCAACACGGTCGTCCGCGGCGGCATTGGCAGCTGCGCCAAACCCAAAGCTGGCTTTGATGGCCTCCACTCGGGCTTCATTATCATCGTCAAAGTtc
acttcctcttcgtcgtcaacggCGTCATGGTcaccatcaacttcagcctCGTCATCCACGAATGATGATGTCTTCAAGTGTTTTTTGCGTGACTGTGAGG
GCTTGGCTACAGCGGTGGATGCTGCCAGACCTGTAATGTGTTGCGGTGGAGTTCGTCCTGCTGGAATCACGTCTTTCACGAAACCTAGGCGACCTCCGTT
GTTATAAACCACCAGTGCGTTCAGCTTGTTGGCAAATTGCAGTCCTAGCGCCGGGTAGTTGATCTTAAAGGACCGCAGGACGGTCTGGGTCTCTAGTTCC
CAGACAAACACCTCCTTCGCACACGTGACAGCTGCCAAGTACAGTCCATTGGGTGAGAATGCCAGGATGTCCACATCAGCGGCCGTACTCTTGCCAATGG
GCAACATTAACCTGCTCTTTGATGTCCACGAGTCACGCTCAAATAGCTCAATAATGCCTTTATCCATAGGCACAGCCAGCAGTTTGCCTGCATCCCCTGG
CTGCCAGGCGCAGCGCAACAACACGTCATCGTCGCGAATATCTCCGtgtttgatgttgaagcactTGGTCTCAGTGGCTCGTTGCGCATCTGCATCCAGT
ACAAAGACTCGCACTGTGGAGTCTTCACTGCTGGCACATACATATTTCTCCTGTGGGTCCAGCATCACACTCTTGATtgctccagtagctcctTCAGCCA
GAATCACCTGCTCAATATTACTGCGTAGAAATACTCGAACAACAGgctcttcatctgcaattGCAATGAACTTGGACGTGCACGTGACGTGACGGATGGG
GACTGTGGCACGACGTATGTGTTGGTCGAGCTCTGAGTCTGGGGGGAAGCTGTAGGTGGAGACGTTGTTGTCGTCCTCAGTGGCTATCAGTACACGCGTC
TGCTCTGGTGTCACTGCTATGGCTGGATTGGAGCAGTCGCTCACTGTGGTTTCCATTACCACGGACTCTGTAGTCAGATCTGTGACGAATAGAACTCCGT
CCTCTCCGCTGGTGAAAACCACGTCGCTGCCTGCAGGTACTTGTCCGTTCTTGATCGTGTGGAGCGTCGTAATCAGGTGCATTGCTCCTTTTCCGTTGAC
GTTGACGGTGATTTCCTTCATGGTCTCCATCGTGGCGCTTAGGAGGTGGGTCGTAACCCAACGAGCTTTTTGGCTGGTAGAATCTGAAATGGCGCGGCTA
AAAACTGGCGGGAAGTGAAGGTTACACTTCGTGTAACCTTACAAGGTAACCCACGTAACCATGTAACCCTCCAAAGTGACGACGTCAGCAATGCGACACT
AGGCAATCAACCGAGAAGGAAACAAGAGAAGACGCTATGGGAGACCGTGGAAATGTGCTTTACGCGCCTACGGGAGAAACGACGGAGTGGGAGGACATCC
TGGTGAAGAAGGGGATCCTTGCACCCAAGACCAAAGTGcaggatgaggaagatgaggtCGAAGAGGAGCAGGTGGACCCTCGAGAGAACGCCACGTTGGA
CGAATTAGATGAGATGGAGGTGCGGTCTACAAGCGATCTAACATAAGACCGTTGCCTTTGCTACAATACCAAATACATGACTGTACTGATGTGTGTATGC
GTATAATATTATGAATAGGACGA