Description :
From Genome Similarity Track
Location :
Scaffold_11:110358- 111968
Transcript NameFunction/comments
g4042.t1KUF98159.1 inorganic phosphate transporter 1-6 [Phytophthora nicotianae

Sequence
1610 bases(100 bases per row)
CAACACGAATGCGGCAGTGCTCAGGTCTCCAGAACTTTGACGTCTGTGTACTACATGTTTTGATGGCGATGTGGAATGGTTACCATGCGTGCCGATTAAT
GTAAGACCACGAAGTTCTCAAACATTTTCCGTGTTATTACCACTTCGATCGTGGCTTACGTTACACTGTACTATGCGCAGCAACTCGACCAACATACAAC
GAGCGGGTTGACGCCTCTCAACAAAAACGACTGGGGTGTCTGGGACCTTTCACAACTTACAGCACAAGACGACACAGCAGCACACTCCAGTCGAAGCTCT
TCCCAAAACACCAATTGTTTATCATCACCTCTTCACTCGCCAGCTTACTGCTGGGCGCCGAAGTCCTGCGTCCAGTAGGTGTCATACTCGCTGCAGGCGC
TGTTGGTGACCAGAGCAAATCCGACGTTCACCACGTCGTCCTTGAGGATGTTGGCGCGGTGGCCCGCAGAGTTCCACCAGGACGTCATGACGGCCGAGAC
GCTCGTTTGGCCGGCAGCCACGTTCTCCGCCGCCACGCTCCAGTCGTATCCCTGCGCCTCGATGCGGTCCCAGGGCTCCGAGCCGTCCGTGCCCTCGTGG
GTCATGGTGCAGTGCGTGGCCTGGTCCTGCGAGTGGACATTGGCCGCGGCCACAAGTTGCACGTCGATGGTCAACGCGGACAGTCCGTTGTCCGCGCGGT
ACGAGTTGATGCGCGCCAGCATCTCCGCCGACTCGGCGCTTGTCAGCCCGTTGTCGTACGTCGTGGACCCGGACGTCTGGGAGGAAGTTGAGTCCGAGTT
CTGATCGGTTTGCGATGCCTGGCTGGTCTGGTCGTTCTGAGCAACCTGGTCGCCCTTTTGGCCGGCGTTCTGTCCAGCGCTTTGGTCGGCCGAGTCGGAG
AAGCGGTCGATGACGTATCCGCAGCCAGCGCCCCAGTAGGCCGAGGCGGTGGCCGTCTCGCCGCTCTTGAGCCAGCAGGTGCCGCCGTTGAAATAGGTCC
ACGTCCAGTGCGTGCACTTGGCGTCGTCCGCGCACAGGTCTCCGCAGACGTCCGGGATGCCCAGCACCGAAGACGTGTCGTCACCGTAGAAGTCGCAGTT
ATTCTGCCACATGACGCGGCCCTGGCTGCCGACTTGGAACGCGGAGGACGAGCCCAGCACCATCGCAGCGACGGCGGCGGACAGTGTGAGCACTTGGGAG
CGGCACATGCTTGCGGGATGTCTATAGAGCAGGGAGAGAGGATTGTTTGGTGCCCGATGAATTGAAAAGTGAGAGACCGAGCACCGGCGTCGGACTCAAG
GTGAAAGGCAAAGGATAGACTGCAGGCAGAGCTTCCTCCGCGCTGGTGAACATCTGGCGGCCAGTTGACGAGTACACGCTGCCAATATCGTTGAGGCGCT
GTCAACTTGGCGCTAATATCGTTGAGGCTGTCAAATTGGTGTTTTGCGGTGGACGTGCCGTAGTAGCGAGTACCAGCGAGCCTGAGAGCGTCGGTGGCCT
GCTGGTGGCTGTGCGCTCCAGGACTCTACATGGCGTGTTCCAAACTTTGGAATACGCTGGCACTCTCATCGGGCTTGGTGGTGGAAAGGCGGAAGTCGGA
GCGCATGCAC