Description :
From Genome Similarity Track
Location :
Scaffold_23:11033- 12702
Transcript NameFunction/comments
Phyta_totarag1277hypothetical protein PHYSODRAFT_298516

Sequence
1669 bases(100 bases per row)
AAGGGAAGTCCAGATGCAAAGATCAAGCAGAACTTTGCCCTGAGTTCTGGGGTCACAAGGTCATCACTGGTTGAAAAAACGGACGGGAACCAATCCATCA
TGGCCAGGATGTGCTTCATCAGCAAAGTCTCCTGGAACACCCGTTCACGATAAGCGCCCCCACGGGAAAGTAGGAAAACCAAAAGGCAGAGACCGCAGGC
AACTTCCAAGTCCGTGTTCCGACCGTCGGAATCGGCACCAAGTAATTTTGCTGTCAACGCAGCTTGATCATCGCTTAAGTTACCGCACACCATTTTGAAG
CCGCGCGCCAAGCTTGAGAGGAAGCCCTCCGTCTCCATCAGAGCGGATTTGCCAGCAGGTCCACACTCCACAACAGCATTGAACGTCTCCAGCATTTCGG
CCACACGCTCTGAGCcttcctcgctgtcgtcctcgtcgtcatgcTTCATCACGGTTTCCAGCAGAATTTCTACGCCATTACAAGCAACAAGCCGAGGGAC
TTCGTGCACGCAAAGCTGCTTCAGTAGATGGCGTGTTTGATCAACCACCTCTGACAACGGTTCCAATGCCTTCTTTTGCTCGTTGAGCACAGAAACCATC
TTTTCGATAGCGTTCTGATGCACAAGCGTGGAGTGGAATGTACTTGACCGAACCAACACGGCAAGAAAGCGGGTGATGGCCAACAAAAACTGCTCCCTGA
GCTTCCTCTCTTCTGCGTCCTCGTTCGCGTGCTCGAATTCGTTGCCCTCGTCCTCTGCTAACTCCAGCAAATATGCAGACACTTCCTCAACGATCTCCAT
ACAATCACTAGGTAGCGCATCAAAATCGGTGACCTCAAGAAACCCTTGCAGCAATTTGCATCGCTTGAACAGCCCCTCTGGGTTCGTCTTGATGTCAACA
TCAAGAAGTTGTTGTCCCAACTCCAGCAAGAACGCGGTCTCGCGTTGGACCGAAGGGGCTTGCAATTGCTCATAAAACTTATCCAAGATGGCTGGGTCTC
TCACTCCATCGTGCAGGATTTTCACAGCATTTTCTTGGTGTCGTTCCGTACCCTTTTGCATCCAGTAAACTAGCGACACGGCACCATCCACAGCAATTTT
CTCCATCTGTTCCGCATCGAGAAGTTGGCCATTCTTGAGGAGTAGCGTCAGAGCAAGAACGCCCACAACGGATGTACGCGGGTCGAAGTCTACAAAGAAA
CCTATCAACATTGACACCAACGTGCTTTTCTCTTCTGCTGACAAGCCAGActcttcatcatcgagaaTGTCGGGGTGTGAGAATACGATATCAATCAGCT
TACGGGCAGCCGTTACCTTCACTGATGGTCGCTTcgctaccaccaccacacggAACACCAGGCGTACGTTAGCGTTTTCAATCAGATTAACCCACAACGG
GCAAGTAGCGAAATCTGACTCGACGAGGTTGAGCACAATTTCCTCAGCCGTTTCAGCAACCTCATCAACGGGGGAAAGAATGTTGCCCAAAATTGTGTGC
GGTAAAACTGCACGGTGGTCATACAGAGTCTTGCGGAACTCCAACGGGTCACTAGACAAGTGGATAAGAATGCGCCCGAGGTCCTGGGCGATCAGCTGCC
GCGCGGGCGATGAGTCTGCGTAATCGTCGGTTGTGGCCTCATATGCGGTCACTAACGCATCCAGTGCAT