Description :
From Genome Similarity Track
Location :
Scaffold_334:11032- 18201
Transcript NameFunction/comments
Phypl_g7097hypothetical protein
Phypl_g7098hypothetical protein PHYSODRAFT_315943
Phypl_g7099hypothetical protein

Sequence
7169 bases(100 bases per row)
ACGGCCGTCGATGATGTCGGCCGAGCGGAGCtcgcagcgcctccatctacgcagttggtgctggctgcgCGCCACGATCGGTACAGGCAGCTCCTGCGCA
CGTTCGTGGCGTGGAAACAGCGCGCGCAGACGCAGTGTGAGCGACGAAAAGTACACCGCGAGTTTCATCCATTGTACTGTAGTTGACGTCCTAATCAAGA
CATAACTGATAATTGTATGCAAATGTGTCTGTTATAATCAGCGCGTCGCGGCTGCGTGTCGTGTGGGGGCCGGCTTCTGCCAGCGCATGTTTTGGACGAG
GTGGCAAACTTTTGTGGCGGGGAGACGTCAAATGAGAGAAGATAGAGCCCTGCAgggtgaagaagaggaacaCTCACCGCAGGAGGAAGATCTTGACAGT
GACCGTGGCGATGTTAAGGGAGAAACGGACGCAGCAGAgtctgcttctgctggagaagagagtgacgacgacaagaatAACGCTGCGGTTTTGCTGCGAA
GGCGGCACCACTTTAAGGTGCGAAGATATGATCATGCGTGAGGCAGGAAAGCTCTAGTTCATTGTTGACATGACTGTTTGCTGTTGTGTTTGTGCTTTCT
TGTGAAGAGATGGAGACGTGCGATGAAGAAAATTGTGGAGAGTGCTGGTGTGTGTGCCAACGGAGTTGTGCGTGTCCGTTCGTTGCACGCTATTCGACGT
TGGCAAGGCTTTGCGAGGATGAAAAAAGATCGtgatgctctgcagcagcgagcctacttcttcttgtactATTGGCTGCTCAAGAGATCGTTGAGGCAGC
TTGGTCGATATGCGCTGGTAAGAAAGCGAGAACGTATGCTGACAGTCAACATCGTGAAAGCGAATCGGCAACGGTTGCTTGTTAAAGCTATGCAGCAGTG
GCGACTGCGACTACGATTGCACCAAACTCTCGGTTTGTGGCGGAATTACGTgtgtcgacgacgtcatcaAGCGCTACTGTACCGACCGATAGCGGAAGCT
TTAACGCGGAAGACTCACTGCCGCCTGCTCCAATTCGCGTTTGGTATATGGGAGAAACGCCATGAACGAAATCACGCCCAGCATGCGCtcgtgcgtcttc
ttgaccGTCATTTGTATAGAAAAGTTTGTGAAAGAGCGTGGAAGACATGGAAAACTAAGGTACGTCAACTTGCCCAATTGGACACTTTTCATCAAGATTA
CCAAGAGCGTAGATTGCGGCTCATATGGGATGCGTGGAGTACTCAAACACGAAAAAATGAACTGCGGGAGCGGCAAAGACGTCGTGCAGTGCGCCATTAC
TATTTATCGCTTTTACGCAAAGGATTGCATGGTTTTCAAGCGTGGCGTACACAGCGACACCTTGCACTAAATCGATTGGAAAGTAtgcaagacgcagcag
cttcgagagcgATGGCGTTGGCTTTTTCACGCTGGGACCATTTCACGAGCGAAAGTAAACTGCAAGCGCACAAGTCTGAACGCGCTTTACTCCATTATGA
GTCACGACTGTTAAAACGGGTTTGGTCAAACGGACTCCAGTGCTTCTTTACCAGAGCATTGACAAAGAAAAACACTATGGTAGCTGCGCAGGAGCAATAT
CATGCCCAAACGTTGAGGCGTAGCTTTGATACGTGGAATGGAGTCTGGCGAGCTGAGCGCATTCGTGACCAAGCCTTGAATAATATGTTGCGAGAATACG
TGGTGGGGAAAGAGCGAGCTGTTAAAGCTCGTGTATTAGAATGCTGGTCGGAGTTTGCTCGCGCAAAAGCTGCCAGAAGGGTCGTAAGTACTCAGGTTCG
GGGCCAAGCACAACAACGAACGGTACAAAACCACTTCTCACATTGGGTTACGTTTGTTTCAGTTCTGCGATGGCAGCAAATTACGCAAGCGCGAGCGGAG
CAGCATTACAAGTCTGTGATTTGGAGAAAGTGCTTCAAACGATGGCGACACAATATAGCCCTGCGTCGGTGCTACCGCAAAAAGACGCGGGTGTCTCTGG
TGCATTGGAAGTTGACGTTGCAGCGCAAGGCGTTCGACGGGTGGAAACAATATCTTCACACCAAGAGAATGAAACAGCACCGTATTCACGAAGCTCTTGA
GTTTCGCCACGAGCAGTTTGTGCGCGATGGTTTGCGCCACTGGATGACAGCTGCGCTGCATTTGCAAGAGCAGCGTGAACGGCAAGTAGCGCGTAACCAA
GCAAGTAATGCGACCCAAACTTGGCGCAGAGTTGCAGCAATAGCTCGACACTGGCGTTACCTTGCAATTCGGCGTCGAGTTAGCAGGGAAGAAGGACAAA
CCTTAGAAAGGTCAAGAAATGTACCACGACGAATTCAAGGAGACATGTACTGGCAATCTGAGCACCAACAAGTTGGACGCACGCAAATCACGAAACCCTC
AGCGCCTCCAGGTAATGAAAACACTTTCAGAAACGCAACCGTGTTTGTGGATGATACCGGAAGCTCGAATTGGATGAAGGAAAGATCCCCGCTGTCAGAG
TTCGTATTGCTACCGAGGAACCGACCTCAACCTCGAAGACCCGTAGAGGTTCTGCTGCTTTCACAGACAGAACCAGAAAACGTACCACGACCCAGCGAGA
ACTCGAATATGCACGAAGCTCTCCGATGCGGCTTCGATTTTCCAGTTGAACCCTTTGCTCCTTTAAGCTCCCCACCGGACAACATGGTCAAGTTATCCCG
TCCTCCCCAGAAACTACCATCTGACACCACAGTGACTGAGAGAGAGCGCAAACCTCGCCAAGGTCTAACTCCTCCTACCCCAGCAATCCCGTCTAGGGAA
GGTGGTGATCTACTCTTGCCAAGCATAACAGCAAGGCACTTGGACGTGTTAGAGCGGCAATTATTGGTACTGAGCCAGCGGAAAAGGGAGTGGAAGGCCT
TTGAGCAACAACTCGAGATAttgcgtgaagaagctgagtCAAACCCACGACTTATTTCAAAAGTTCGggcgatggaggagcagcacgcgacTCGCACAAA
GCAATGGATTCACACAAAAAAACGGATTCGCTCTCTAGCAACAGAGATCCAGCAATTGAGAAGTGTTTTGAAGAGATGATACCAGAAGAAAGGTATATGT
CAGCGTCTTTGTATCAGATGCCCCTTTACTAGACTTTGCAGCTCAGTGCAGAAAGGTTTCGTATGCGTTTATAAGTGTGGCGCATTTGTCGAAGGAGGCT
TCAAAGTCAGCATCCTCCATTCCATGCTGTTTGTACCAGTGCACGTAGGCACCCGCGTGAAATTGGCGCTGGGCTCGTTCTAAGAAGCGTTTCGTGCTCG
TCAGGAAGTCGCCATTATTCACGCAGATCGTTGCAGAAGCCTTTGCttgcgaagaagaaaatggtGCCGGTCTAGAGAAGGTTGGCGTGGCTTGCCGCAT
TGCCGCTAACCATGGCGCAGATGGAAATGCAGTCTGAACGATCTGACCAAGGTTTTCGGCGAACCGACCAGCTTCACTCGAGACAGGGTTGAAACCGCGA
ACTACTGTACTCGATCCTATGGTTGGGCGTGCACTACGTGGGAAGGACGCTGCCGTTTGCTGCACAAGCTTCTCGAGCATGTCTAGGGACGCGTCGTAGT
CTGCAACGTGTTCATGTCGAAGCGACAGTGAGCGCGCTTGAGCGACTACCGGCGCGTGAAACAAGGTCGCTGATGATATCGTTTTTGCTACAGACGTCTT
GGAAGGAAGCTTGCTGCGTACGCCTGATCCAACACGTTCTCGCCACACACCGGAACGAACGTCAAGCATCTTGGCCGCCGGCATGGGGCATACTTCGTGC
AGTAACTTGCCGAAATCGAACGGCCGAGCAGTACTAGCATCTCCCATTGCCGCTGGGAACAAAAGCCCCGCTagatctgcagcagccatggCATTCACCT
CTGCAAGAGACACCCGCTGATTCGCACTGTCAGTTCCCACCCTCCCCTGGACTAGAGCCTTCCAGTAACCCGCCGTTCGCAACAGCTCGTCGTTATCCTT
GTAAATAACAGCATCTGCAACGTCTTGCAGACACCGAAGCGTCAACACGGCATTATAATTCTGAAGTGGCGTATCTCCACGAGTGCACGATGGAGCCACC
GATGCAGTTACAATATACGCCTTCGGGTACGTGTCCCTCATGGCTTCCAGCACTCGACAGCCCAATCCTGATCCGGTTCCTCCACCTAGAGAGTGCATCA
GCACGCTGCCTTGATAGCAATCTACGGTCTCAATTTCACGTCGTAACGAGTCCATCACTAGCTCCACCAGTTCTCTGCGGTCATCCGCAGCTAACGACGT
GAAggccggcgctggagcgtTCCGACTCGGTCCAAAGTACCCCATGGCCCAATTGTTGCCTCGTCCCGCCTGCTCCACGTGCGTATGAGCGGGCTGGAAA
GCCTCAGCACCTTCAGTATCAGATTCATATACGGACCGAACCACTTTGGGCTCCGAGTCCACGAGGATgcaccgagcagcgcgagttgACGGGTGGAACA
GATGCCTGGACAATGACACACCCTTCTTGGGGCCGCTTACAGCAGCGGTGGGGCCTCCAGACGCGCGACGAGTCTGTCGAGAGGCACCAGAGTCACTTCG
ACTACGGTTCTCGTCGTGAACTTCGCCCGAAGCAGCGGCCAGGCGCCAGTATGCGGCGCCCAACTGGTTGCCACATTGCCCCACATTCACATGCACGCTC
ATGCCTTTGAAAGTGCTCAGACAGCATAggattggctgaaatggTGCTACGATCGCCTCGTAGggattggctgaaaaagGGATTTCGTACTGGTGGCTAC
CGGACCAGTACCAGACCATGTCGTCTACAGCATACGACGTGGTGCCGTTTGGAGGACGCTTCCCGTCATGGGAGGCCTTCGACGTGGCGCGCAAGGCTCA
CTGCGAcaagacgtacacgatgTACGTGTGCCGCAACACCGTCAAAGTGGCGGtggccaacaagcgccgcaaACTGCAGGTACCCCACAGTTGGGTCTAC
GACCGCAAGGTGTGTCCTCCAATGTCCACCACTACTGTCCACAATGGACCGTCAGCAATAACTCCAATGCCATTGACACCTGCATTTGCCCAGATCTACG
TGTGCACTCATGGCTACAAGCGGGTGTCGCGGTCAGGTGGCTCGCGACCTCGACAGAACGTTCGCTACACGGATTGCAAGGCGCGCTTCACGGCATGTGT
GGTGAGTGAGCTGTTCGATGATGGACGCGAAGTCCTCTTTATCAAGGTCACAGGTCAGCACTTGGTCCACAGCGACCACCCCGTGAGTCTGGAGCAGTGG
CGAATGTACTCGCAGAACCGGGCGGCTGTGATGGAGCACCCGTATCTTACGCACGAAACGGAGCTGATGCGTCGGATTGGATCCAACAAGAGAGCTGCAC
AGGAACATATCGAGACGTTAACAGGCAAAGTGTGTACTATGAAGGACATGCACAACCTGTACGCGAGGCTGAGGAAACGCGAGAAGAGCGCATGCGCCAT
GGATACAGCACGATCCCAACCACAACAAGCGACCACGGATATATCTTTAATAGAGCTAGGTGCTTCACAGAACGTGATGCATCAACCCAATGACGGTGCC
AGCAATGCTCGGGTGGAGCCTTTCTTACAGCAGTTCGTGGATGCTGATGTGGAGAACCATGTGAGTATCTTGTcaggcgacgacggctccAACGAGGCTA
TTTGTTTGGCCAGCCGAGCCATGAAAGAACACTTCCAAGGGTTTCCGGAGCTGGTTATATTGGACGTGTCGGTGGAGACACAGATAAAAGCGCAGCTACA
CGGATTTTTATCcatggacgcgctgggcaATGCCAAGCCTGTTttcttggcgcgctcgaTGCCCATATCGTCATCGTTGTTGCGCCGAGTGTGTCAGGAT
TTCAAGCGCACGCACCCCACGTGGAGACAAACCAAGGTGCTGGTTATGAACAAGCTATTGCCCGACGTCATACAAGTGTTGTCGCGTGAGTTTCCTGAAG
CACGAGTATTACTATGTCAATTTCAcgtgcttcagctgcttAATGAGCTCGTGGCACATTCCCAGGAACCAACACAGATCCAAGCAGCAGACTCTCGCTC
TGGGATAGCTGGTTGCAAGACCTTGAGCCAAGACAAGATCGCCGAAttgctccagcagcttgcgtTTGCACACTCAGCCTCGCGGTACAACGAAGTAAAG
AGTTTGTTTGCTCGGCAACTGGCTGTTGGGGGAAGGAAAGAGCTGCTTGCATGGTTTGATGCAAACTGGGAGCCGTATCGTGCGCTCTGGGCATCATGCG
CACGCTCGGATCAGTTCGACTTCTCGTCTTTCTTTACGAAGGGCATGAGCAGCTTTTGGGAGCCGATGAAAGTGGCTTTTAGTCGTGCCAGTGATTCTAT
CTTCGCTGCACCCGGAGTCACGAACGATTCTCATCCTCTCGGTTTGATGACGGCAGTAGCCAGCCGTCCACCATTTCTCGACGTGCCCCTCGTGCCCGTT
GCAGATGCAGCTGAAAACGAAACCAGATCGCTGCAATCTTGTGATTCTAGCACAATATCCTTGACAATGGCTCTTCGAGGTGCAGATATGACACAAGGTG
ATAGCGGCAACTCGCTGGCTCACAGCATCTCTGAAGTGCTGGCGATGATGAAGTTTGTCGAGAGTGAGTGGACGTCCAAGATGTTGATCCTTGAACTGAC
CAAGCCTGTTGTAGTGAATCGTTGGGACCCTCTATTGCATTTGATGGTCAACTGCCTCAGTGGTTTCGCTGTGGATCTGATCAGCTCCCAACTTACCATC
CAAAGCTCGCGGCCCTGCGGATCTGTCACCATCTCTAAAACTCGAGCTCCCAAACCAAGCAGCGCCAAATCCGAATCCAGCGACACATCCGTGCCTACAA
AGCCGCCAGCTCCGGATGCGATGCGCTGGTTAAACAAGACGACGCGGGAGAAGCATATATTGCAGCGCGATGGCAGTGCCTGCGACTGTGGGTTCTTCGC
ACTGTACCAGCTACCATGCCGCCATTTGATTTGGTACGAAGTCGTCGCTCTGCAGTACAAGCAGCTCAGCCTGTCAGCGGTGGGCCCGCGGTGGTTTCTG
CGGTCGTTCCAGACTCCGAAGCTGGGTAGCGAGCGCGAGTCTAACGAGATCGAGTATCACCTGCTGTGA