Description :
From Genome Similarity Track
Location :
Scaffold_7:110304- 117032
Transcript NameFunction/comments
Physo_516577predicted protein
Physo_518013Hypothetical protein
Physo_519103Hypothetical protein
Physo_318736Hypothetical protein

Sequence
6728 bases(100 bases per row)
CGAGTCAGGCCATTTCATCTTGTACCCTACGCTGGCTGGTATCAAGGTGTTGAACATCGAGACGAACAAGGTTGTGAAGGTGCTGGGTAAGGTAGAAAGC
TCGGACCGCTTCCTGCGGCTGAGTCTGTTCCAAGGGAAGCCCAAGGTCAACACGCAGTTCGAGAAGCACCTGAAGGCTGCGTCTGGACTCAAGCACGAAG
CCGAGGTCATGTCCGACTCCGCAAATGAGCGCGACAACATCGACCCGACACTGTTCTGCACGTCATTCAAGCGTAACCGCTTCTTTCTGTTCTCATCTCG
TGAGCCCGAGGAGGACGAGGGCGAAGACGGCAGCGCTGGTGCCGGCCGCGACGTTTTCAACGAGAAGCCAACGCTCGAGGAGGCGCAGGTGGCCACGGAG
TCCAGCACGTCCAAGGTGCTTGGTGAGACGGCAGTCATGCACACGACGATGGGAGATATCACGCTCAAGCTCTTCGGCAAGGAGTGCCCCAAGACCGTGG
AAAACTTCTGCACTCACGCGCGCAACGGGTACTACGACAACCTCATCTTCCATCGTGTGATCAAAAACTTCATGGTGCAAACCGGTGATCCGCTGGGAGA
TGGCACGGGTGGCGAGTCCATTTGGGGCGGCGAGTTCGAGGACGAATTCCACCGCAGCTTGCGACACGATCGGCCGTTCACACTTTCGATGGCCAACGCT
GGTCCGGGTACCAACGGCTCGCAGTTTTTCATTACGACCGTACCGACCCCGTGGCTGGACAACAAGCACACTGTGTTCGGCCGCGTCGAGCAGGGTAAGG
ATACTGTCTCAAACATCGAAAGCGCGCGCGTGGACAAGTCCGACAAGCCTCTCAAGGACATCAAGATTATTAACATTGATATCTTCTAGGTCAGGGAGCT
CTGGATCCATCGGTTGATGATGCTACAGGAAAAATACACTCAATGGATGAAGACAGCTTCGAACTAGGCTGGAGATGTCGCTGGGTTCCCGCTTTCTATT
GCGTTGCCGATTGTACCAGTACCTCCAGCGGTGGCGCTGCTACTGTTATCGTTGTTACCAGCATTCGCTGCCAGTGCGAGTGCCGCAGTGTCGCTCAAGC
TCTTCAACCGGTCGCCGCAGAGAAAGTGGCGGTAGATCTGTTGACGAGCGCGCAGCCACTCGAGACGGTTTGCAGCTTGGTGCGTGACGTAGCGGAAGCA
GATGCGGCCAGCAGCGGGGATGGTGTTGGTTTGGTACATGGAGTAGATGATGAGGACGGTGGACCGCGTGCTGTCGATCCGGATCATGTCCATGGGGCAC
GAGATCGACAAGTCCACAAGCGCACGTAGCAACATCTTCTCGTCGTCGCGAGTGAAGTCCACCTCGAAGTCCATGTCCACAGCCAGCGGCATGATCGTGC
TCAAATAGCCCAAACCCACGTACACTCGTGGCCGATCAGTCATCGCGAGACGCTCGAGTAACTCACCAAAGCACTCCAAGTCGACAATCGCGTGGTGCAT
GGCCACCAACGCGCGCAGTCGGCCTGACTCGTAGTTCTTCGGGAAGTGCTGGAGAACGTGGTGGGCTTGTCGTGTGAGTATCCGTCGGCCGGCGATGGCG
AGATGGAACAGTACCAGGTGATACTTGAGATTCTGCCGCTTGTGGACGGGCACGTAGATCGCGCAGACCTCAGCGCCGACCTGAGCTAGCAAAGTGGCCA
GCTCCTGGTCTGTCATTGCCGTCTGTGTTGCCTGAATTAGGCTCTGGTCGAGCTCTGAATTCTCCGGGAAGTCCAAGCTGTGGTCTTCAATGTACTTGTC
CTCGGGCCGGATCGGCGAGACGTAGTCGAACTCGAGGATTCCTTCGTACGGCAGTCGATCGAAGAATGTGTACGTGAGCTGAATGGGCTTTTGGTTGAAG
AAGACGTTGCGCCAGTAGAAGCCGCGGCCGTATTGACTGCAGTCTGTCCGCTTGGGATGGTATCGGGCCAGGGTGGCCGCGTGGTGGGCGTTCAACGAGG
CGAACCAGAGTGCCAGCTTGCGATGGCGCGTATCTCGGAGTGTCAGTGTCCAGTGGCCCGTTGGGTTTGCGGTCGAGAACTGCATGGTGACCGGGCCGAA
GCGATCGATGAGTTTCCACTGCTCCGCTTGAGTCAAGTGCTGCTGCAGGAAGCTGAAGACGTTATCGCCGTCAATTAAACACGGCCACAGTCGGCCAAGG
AGCTCCAGCTTTGGCAACGAAGGGTGCAGATGAGATACGAAGAACGAGGCTTGCGTGGTCGTTAGCTGCAGGTCCGCGAGCACCAAGTCCAATAGACTGA
TCATATCGCGCGAGGAGAAGCCGCGTTTGACGATGTGGATGAGGCCAAGGCAGGAGTCCTCGTCTAGCCAAGACACAGGCCCGCGGGGGAGCGGTGGGGG
CAGGAATGTCGCTGCTGCACGCAGAGTTCCCCTCGCAGGCAGCTTCCAAGGTGCTTTGCTCGAGCCCGCTACGCTGTAGAGACAGCGACGCTCCTGGTCT
ACGGCCAAGACGAACCTCCTCTTGGCCGACTTGGCCCGGGCTGACTTGGCCCTGGCCGATCTGCTCCTCGCCGTGCTGGCAGCGGATACATCGCCTCTGC
CTCCATCCTCTTCGTAGCTGATGTCTGAGAGCGCGCACCTTCCTTGAATCAACGCAGCATCGAGCAATTCACTCGCGACAGCGAAGGCAAAAGGAGATTC
CCCTATCCTGAGCTCAAATGGAGAAGACGCAGACGGCAGCCTGGCATCGAAGATGGCGGACGTGTTGCCAGCTCGAGTCGAGCCAACAGATGAAGTTTCC
AGGTCGTGAACAGACAAGTTGATCTCACAGCGCGAGCCCAACGCAATAGCACGCAGAAGAGCGCGAGCTCCGATTTCTCCAAGGCTGTTGTCCTTCATGT
CCAGCGTCTGTAGAGAGCGGTTTTGACGCAAGAAGAAGCCGAAGGCCACGGCACTCGCTCCGGTCAGTGCGTTGTGCGATAGATCGAGTTGCGTGAGCGT
CGTGTTGCATGCCAGCGCCGCTGCCAATTGCTCTCCACCTCCGTCCCCACATCGGTTCATGCTCATGTGAAGCGTTCGCAACGAAGTGTTGGTGCGCATC
GCGATCCCCAAAGCCACAGCACCAGTACGTCGAATGCTGTTCCAAGACACGTCCAGCGCCCGCACGTTGCAAGTGGGTGTCGTCAGCATCGCACCGAGCA
GGATTCCTCCACGCTCACCGAGCGAGTTATGCGAAAGATTGACTCGTTTCAAGGACGGATGTGACTCAATTGCAGCCGCAACAGGAGCAAACGCCTCGTC
GTCGCCGCCCAGTGTTGTATGGGATAGATCCAAGTATGTGAGAGTGCTGCAGACAGCCAGAAAGCGGGCGATCTGCTTACACCCTTCCCGACCAACTTCG
TTCTTGCTCAGGTTGAGCACAGTGAGCATACACCCGGACTTTAGCGAGGAGTTGTCGACACTGTCCCGCTTATGCCGCTTTGCAGCAGCTAGAAGCTTGG
CCTTTGGGGATCGGTCGTCGAAATCTTGAGTGTCATCCGCTTCACGGTCCGTGGCGGCCGCAAGGGATTCCAACAACGGGATGATAGAAGCGTCGGTTAA
GCGGTTGTCGCTGAGGTCTAAGACCTGGATGGCCTGGAATTCTCGAAGTGACGTGGATAGAGCGATGATCTTGGCATCTCCAAGCCCGAACTGTTGCAGC
TGAAGAGCTAGATGACGCTTGCCACGACCAGGACGATCGTTAGAGTTTTTACTCCTGGAATTCATGAGTAATGATGCCACTGCAGCGAAAGAAGAAGGCG
CTGAGGATGATTTTCGTGCTGTGGGAGGTTGAGAGGTGGGGGCTGCCACCTCGTTGATCCTCGAGAAGATCGGCTCGGGTAGAATCTGCGTCTTGACGCA
TTCGTGGTAGAACAGCGAGCGCGGCGAGAGCTTCCCGAATAGCTGGCTCGCAGTTTGTCGCTCAGGTTCATCGTCACTGTCTTCATCAGGCCAAGAAAAC
CCGTGATCGTCATCATAATTGTCGGTCTTTTGGCGAATTTTGTGGAAAGGGAGAGGGCTGAGCTGCTGATGGTGTTGTGCTACTTGTACCTTCTTCCACT
TTGGAAAGAGATGCTGTTTGTCGGCGTAATACTCGATCTGTCCAGCGTTCGTTGTGTGTTTCTGGATCTTCTTGATGAACTTTCGAGCTTTTGGGAGGCG
AGGAATTGGCTGCTGCTGTTGCTGAGGTGATTCAGCTTCCTCATAAAGCCATGGAACGATCGGATGATTTTCGAGTACATTTGTATCGGTGCTTACCGCG
TTCAATACGCTCAATTTCCTCGATGGTAGGCCATCAACTCGCTGCTCCAGTCTCATTGCACCTGCTTCTCTCTTACGCAGCATCGCCTCGGCGTCTTGAA
GCTTCTGGTCAAACCTCAAGCGTTTACTGTCGACTTCTTGCACAATAACGGGTGCGGCGGGGCTAGCAATCACGTGCTCCAGTTCCCAACTGACTTTCGA
TGTATTCGCGAGTACCTCATCGATGGTTCGTGGAGACGGCATGGCCTTGTCATCGAGAGTTTCATCCGTGGTGGCGTCTTCATCTGGAGTCGGTTCCTCC
TGCGCGTACAGCGGCTCAAGCCTCAGACTCGGGTACATGAACTTCTCCACTTCGCCGTCAATGGTGGCCTTCCACTTGCTGTCGAGCGTCTCGAACTTAC
CGATGGCGTGCTTCTCGTGCGGTGTTTTAACTGTGTTTTTACGTGTTGGGGAGGTGAGATTGATCCGTGGCAAGACGGCGGGGTCTATCGGCATCACCGA
CTTCCGTCGAACTTTGACAGACAGACCTTCGATCTTCACTCGTTTCTCCTCCTCTTCCCCTGCTTCCTCTTCGTCCTCCTTTAGTGGCCCGTGAACGCCG
ATATGGTATTTGCGCATGGACTTGAGCTTCTTCAGCGTCATGATCTTTGCGTGCGTCACGGTGGTGACTCCTCGCACTGCACCGTCGTGAACGGGAGGCC
GATGCTTCTCTGCTTTGAACGTCTGCGCCCGACTGGTTCGTCGCGATGCCGCTCGGGCCGCTGCTTCCTCGGGGTCCCCAGAATCGGCTCGAAGCGTAAT
GGCTTCGGCCGAAAGCGTGAGCGAGTTCAACAACTCCTGGCTGCGGAAACTCTGCCGTGATCGCCGTCTAGGCTCCCGAAAAGAGGGCGCGTTGTTCATG
GTGTTTCGTGCACAATAGCGTTGAGATGAAGAGATGGCATGGGATGCGGTGACACCAGACAAATTAAGACTCGACATTAGTCAACTTTGGTGCCAATTGA
GACTGTGTGATCGAAGTCTTGATAACGGCGATGAGTTGCCCAGACCTCCATCTAAAATGGAAAACAAACGTCGAAATGAATCGGATGAGTACGTTCATGA
CAATAGCAAGGAATATTAAATCCAGACCCCACTCGGCTTTTGCAGTATGCAGAACTCAAGCTCCATCGTTTCTTCCGCCAGCTTCTCCCCGGCCTTTGCC
AGCTCACCAATGCCATTGTCGATCTGCGGTAACCACGACTTCAGGAAGTACTGGCCGTATTCAGTCTTGTTGTGGTGCCACGTGACGACCCACACGTCGA
TGAGCTGCATCGTTGCGTGGTTCAGTGCCACTTTCTGCTTGGCCTCTTGCTCGATGGTGTACAGGTCGACCTCGTACCACTTGTCGCTCCGATCCACGTT
GACAAGTCTCCTCGTCATCGTGATGGTCTTGGTGCGTTGAATCCGATCTTCCAGCAGACTATTGAGCAGCTTTAGCCCGGCCACGAAGGTCTCGGCCATC
GCGACATGGTTGCGCTGTACTCAACAACAAATTAGTAAAGAGTACCGTTACTATATACATCCACAGCACACGCACCCCTTTTTTCTTGCGGAATTTCTTG
TCATACTTCCGTTGTAAGCTTAGGCAACGTTTCCTGGAAGCCCGGAACGTGATGACTGCTAGGGGCAGATCGTCCTCGGAATCGCTCTCTTCGGTCTCCT
CCTCTTCCGAGTTGAGTGTCGCCAGCGAAGATTCGAGGATTTTATCGAGGAGAAGTGCAGCCGCATTAGCGCTGGTGATGTCTTGCTCCTCAACAGAGGT
AGGGGATGCAGGGATTTCGCTGTCGTCGAACTCATTCAGGAAATTCTCCATGGATTGCAGCTCGATGTCGTCCATGGGTACTATATGGTGTGGTGGCCCC
GAGGGAAGAAGAAGAATGAAAGAGGCCAGGTGTCCACCCTGATACGCAGAGAAGCATCCGATCTGGGGACGCTGAAGTGAAGACGACCGCGTCATCATGT
AGAAGGTGCATGGAGAGTTCCATTAGACCGCTGCATCTTTACGTCTACACTACAACTACAACTATTACAGTATACAGTACTACTCGGTGGATTAACAGCA
ACTACACCCACACCCCGTTGGGCTTCTGCTCCATGCACCACTCCAGCTCGGTGGTCGCCTCTGTGAGTTTCTCGCGGAGGTTGGCCAGGCCTTGGATGTA
GAAGTTAATGTCCACCACCGTGTCCTTGAGGAAATATTTCCCCTGTTCAAGCTTGACCCTCGTCCAGGTCGTCGTCCACGACTCGGCGTACTCCGTCGCC
GTTTGGTTCAGAGCAAGCTGCTCCTTGACCTCCTTCTCGATTGTCTTCCGGTCCCTCTCGCATGCAGCAATTGGTTGAGTTTCCTGCTCGAGAGAGACCA
ATCTCCTCGTCATGACGACCATTCTCGT