Description :
From Genome Similarity Track
Location :
Scaffold_435:11030- 15056
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_435-abinit-gene-0.31Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_435-snap-gene-0.14Isoform 4 of UPF0533 protein

Sequence
4026 bases(100 bases per row)
CGCGAGCTCCAGCTTCCAGGCAAGAACCTGTACCTCATCGGCTCGTCGCCCGTGTGCGACATTCAGACCCCGTCAGCGGCGAGTGACATCCACCCCGTGC
ACGCGCGCATCGTGTTCGACGGCGTCTTCTTCGTGCTCCAGGACCTGTCGTTCGAGGAAAACCCCAAGAAAAAGACACGCGTGTCGCTGCAGCAGCCCAC
GCGCATCGGCCGTGGCGACTGCCTGCTCTTCGGCTCGTGCGTGCTCTACGTCGTCAACGTCTACCGGGCGTTCCGGGACCACGAGCCTGACATGAAGGAG
GTGGCGTTCAAGTGCCACCTGCTGCGGCCGTCCAAGCGCAAGTCGCGCTCCAAGGAGAAGTACATCCCCTTCGGCTTTCGCCACCACACGCAGGACCCGT
TCGTGTTTGGCAAGGGCCGCCACTGCGAAGGACATATCTTCACGTCCACGCTCAGCGTCGAGCAGTTCGCAATACAGCTCGACCACGGAGCGTGCTCGCT
CGTGCCCCGAGCCGCCGGCATCAACCAGGGTATGTACTTCCTACTTGGGAGGGACTGTATGCCGCACGACCTAGCGTATAGACCCGATCTCGTGCGTTAT
ACCAGCAAAGCGCTGATGCTCGTCGAGGGCTCGGTCTTCAAGTGCGGCAACACGGAGCTTGAGGTCGTGTACGTGAAGAGCGAGTACCAGGCCGACGTCG
CCATGCGCGTCGACGAAGTTAAAGAGAACGCCTATTTTCTGGGTCACATGCCCTGGATCCAGCAGATCGCGCTCGACCGTCACGGGGTCGAGAATGTCGC
CCAGCGAGGTCAGCGGCTCGAGCTGCAGCCTGGAGACACGATCTACGACGAGGGCGACCCTGCGACGTTCCTCTTCATCGTGATTAGCGGAGAGGTGCAG
CTGGTCGGCCATCGCAGCGACCTCCCGAGCTCATGGCGGCTCTCAGCGATCGAGGGCTTCCTGTCGCCGCCTGATTCGTCGACGCCTTTGCCCGAGCCCG
TGACAGAGAAGGTCGGCAAAGGCAGCTACTTCGGGGAAGTGTGTCTCTGTGGCGACAGTCTCGAGTACGCCGAGAACGCCAAGGCAGCATCGCCTTGTAT
CCTGCTGGCGATCAGTCGAGAAGACTTGTGCGGCTACTTCTCGCACTACATGGACATCATCACACCCCACTTGGCGTACGAGAGCCACAAAGAGCTGCTG
CAAAAGCTCCGAGTGAACGTCGCGTGGCTGCGCGAGTACTCGTATCAGGAGCTGCGTGTGTTGGCATCCAAGGCCGAGCACGTGTGCTTCGAGCAGGGCG
AGTCGCTCATTGAGGACGGTCTCTTTCAGATCAATAACTCGCAGCGCTGCGGCGGTCTCCTACTGCTCGGGTACGGCAAGGCCCAGCTCCTCGGGAAGCC
TGAGCCGGTTGCCACCACAGACGACGAAGAGGTCACTGACGATGGCGACGTGAAAACCGCCAAGATGCAGGAGCTTTGGAAGGCGAGCCAGCCGATTATG
TGCTCCTCGACAGTGCCACTGGATGCGCTTTTCCACAATATCAAGGCGCGGTCGCGCGTCGAATGCTTCTTCTTTGACAGCGTCCACGTGGCACACCTGA
TCAGACAGGAGCAGAACGCCAACGGTCAGCTAGTAGGGGACATCATCAGCGCGCTTCCACCGCAGCTGCGTCGGGGGTCAACGAACCGCCGCAGCAGCTT
TGTCACGCTCCAGCAGCGCGCGCGCCACTCGCAGGTCATCATGACATCCGCGAACGGCGGCGCCGATGAGGAAGACCGGAGTCTGGAAAGCAGCGGGGAC
GTGGAGGAGATAAACGACCCCGCGCAGAAGTGGCGGCGCAAGAAGCGCAACAAAGCGCTGCTGGAGAAGACAATCCTAGAGACACAGCAGAACGGCGACC
TGAGCAACGCGCTCGTCATGTACGTGCTATCGGGCGCCAACCGCGGCGACATCCACATCGTGCGCAACCTCGCGACGGTCGGTGGCATCCTGAGTGACGC
TGACATTGAGCTCAACGATCGGTACGTCTCGCGCCACCAGGCCGTGATTCAGCACCGCGAGAGTCGCTTCTGGCTCTACGACAACGCGAGCGAGTGGGGC
ACATTCGTGCGCCTGGAGGAGAACCAGAATATCCAGGTGTACCCGGGCGACGTCTTCATCAGCGGCGAAGTCGAGTTCACGTGCCTCGCAGCATTTCCTG
TTCGCAAAAAGACCCAGATATGCTGCATTCAATAGAGCGAGACAGATACTGTTTGGACGAGAGTTCACAGCCTTTCAAACCACTCCTTCATTCGTTCCGG
GTGGGGTGTTCTTCGTCTTCACTCATCACGACGATCAGGCAGGATCGATACATTTAAGCCCCGCGCGGTGCCACGGCCGCCGAATGCACTAAGATGTGAG
CTAGCACGTCCTGGGCAAACTCCTGCCCGGTGCGCAGATCGACGCACACGACGCCGCGAATTTCTTGCAGCCCTCCGACCGTCGGCAGGAACTCCACTTG
AATGTTCTGGGACGATTTTGTTGACAGCAGTCCAATGTTCTGCGATAAAACAAAGTTGAAGTTGTCAGCCAAAAGTAACAACATTGGTCAAATCGAGAGA
GATGGCAGCAAGAGGTCGATCGACTGCCTGGTTCTACCTGGTGTGAGAGCGAGTGGCAAAAGATGCCGCTCATCTCCTCCTTGCGGAACTGGAGTTGCAG
CTGCAGGTTATGCGCAGAGTTGTTGACAATCTTGACATCTGCGATGAACGGGATCCCGCAGCTGATCTCCTTGGGAAGGTTTTCGATCGTCACGGTCACG
TCTCGACTCTGATCGGTTTTCCGCATGACGGGCTGACTCTGCACTGAGCCCGCCTCGCCGACGGACGTCTTCCAGCTAACATGTAGGCGCCCCAAATTAT
GCGAGGCCTACAAAATTCACAGAATATGTCGTTAGTATCGCTTGAGAATCAACAAGAGCGAAGAAATGGTTGTCGGTTTTCGCATAGAACAAACTTTACC
TGGCTCGCCACGTTCGCTGGGTCTGCTGTCGGGTCGTACGTGATCCGGAAGACGCGCTGAAGCTCCTCCTGCGGATTCAGTAATGACTGCGGGCCTTTTT
TCAGCAGCTCGCTCACGCCGTCATTATCCAGTAGAGTTGACGGTGTTTTGGCTTTCCCCCATGAGTCAAACTCCTCCGCGGCAAAGGGGAGCAGCGGCAG
GAACTTGATGCTGTCAACAAAGAGCGGGAGCTTTGAGACATTGCGGATCTGCGCTTCGACGAGTGATTCGTCCTGCAGCTTAGACTGCTTGAAGTTGATC
ACCAGCGGGTTCTGCACGGCGAAGCGGTAGAACTTGCGAAGCGATTTCTGCTCATTCGAGATCGGATCCACGTACGACACCCCCACACGAAGGCTACATG
AAATTATAACATGGTTTGGAGCAGTGTGAGTGTTAGCGGCGCTATTTTGCCAGACTGTACCGCCCAGCTCAGCGAGAGCCCTTTTTCGGGTACGCACACA
TGGTTGCCGATCTGGTTGAGCGGGTAGTCGACGACCATGTCGATCGACGAGCCGGCGGGGAGCACTTTCGCCGGGTTGGCCGGCGGCAGCTTGCCTGTGC
GCGCGTAGCGGTTGTCGTGGAGCTCGACGCGGTCGTTCGCGCACTGGATGTTGACTGTGAGCCCCACGTCGCGTAGGTCGCACGCATATTGGTTGATCAC
ACTGATGTAGCTACTGAACGTGTTGCCCAGGAAGATCTCACTGCATGTGGTGCGCAGTAGCATAATAAGTAGACGTGTACGAGTGAGTACCTCATGGTTG
TCTTCAGATAACAAGCTAATATACAAAAGGACGCACCCAAAGCTGTCGGGCAGGATGAGCATGCTCGACATGGCGAACTCGTGCTGGAGTGCGGTCGCCT
CCGAGAGCGTCGTGGGCATGAGCGACCCCGACGACGCCCCTTGCGTGAAAAGCTTGGGCTTGTACAGGCGCATCACTGGCAGTAATCAGCACGAAAAGGA
AGTAACCGCATGAACGAAATGGTTTC