Description :
From Genome Similarity Track
Location :
Scaffold_1846:1103- 2965
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1846-snap-gene-0.1Pre-mRNA-splicing factor ATP-dependent RNA helicase

Sequence
1862 bases(100 bases per row)
CTCGAGGTGAAGCTCGCTGCGGCGAGCATCCTGCGCGAGTTCCACGTAGGCGTGCTCGCAAGCCAGGAGGTCGCCTGCCAGATCTTGCCCACGATCTCAG
TGAAAGGCACGGCGTTTATAAAGGCGACGAATCCGCTAGCAGTGTAGAGAAACTACTGGATGCGTCATGAGAACGCATGTGCGCATGTACCCGCTGGATA
CCAGCCAGCCAGTTGCTGTGAACCCGTCAATACCAATGCAATGTAGCCATGTTGACCACAATAGCACGCATTCATTGGTCAATATTGGGATGGGATTCTA
TTATAAATGAATTATGACCAATCAAGAAGCTGTACCTTCCCAACTTGACCTCTCTTTATCTACTCTTCGCTTGCTCATCCCTTGTACTCCCAATCGAGAG
CAGGATCTCGATCTTGTCCTGTGCTTTGAAAATCTGTTACCCTAACACAAGAGAGAGAACCCTTCGAGACTTTCTGCCATTGCACAAGCTGCCCACGTGA
TCAGCTTCATTGAATAACTCCAGCATCAGCGAGAAAAGTGTCCTTTGCAGTCCTGGAGAATGAGTAGTCCGTCGCACTTCTTGTGGAATAACCTCCGCTA
CTTAGAGCGACAACTTGGCTACCTTGCGGCGGCTTTGCCCGTGTTCTTGGGCATTTTCTTGTTGCGTGAGTCCTCGATTTCCTTGGTCTTGTAGTAGTGT
GGCGCAAGCTCCGTGAGCCACTCGGCCTTGATTGGGATCACGGACCGCATGTACTCCTTGGTCGTGAACGCCAGCTCGTGGTAGACCACCCAGGGCGGCA
CCTCCTCCAGCTTGATCAGGCACGAGCTCGGGTGGATGTACACCGAGTGCGCCTGCTTGACCGTCTTGTAGTGCCCCGAGCTGTCCAGCTTGGCCGTGTT
GTAAAAGTACCCGGCGCAGATGGCCTTGCGGATCACCTCGTGGTCCGTGCGGTTGCTTTTGCGCTCGAGCTCCACGCGGTCACAGAGCCCCTCGAGCTGC
TCGCGCACATCGCGCGCCGTCTTGAGCGAGCGCATGATCACAAAGTTCTCGTATGTCCACTGCGTCGAGTAGTTGGTCTCCACCCACTGGTTGTACACGT
TCATGAGCGTGATGTGGTCCCCGCCGCCGCCGCGCGCAAAGTTCAGTCGCGCGTTGTCCGCGTGCACGGCTTTGTCCTTCGGCCGGTAGAAGATCGAGTT
GTTTACGCTCAGCATCGCGCACACCGTCATGACCTCCTCCGTGCATCCAAACTTCTCGGACGCCACCAGCGCCTTGGACATCATTGGGTCCAGCGGGAAT
TCGGCCATCCGTCTCCCGAGCTTCGTCAGCTCCCCCCTATCGTTCAGCGCGCCGAGGGCATACAGCTGCTCGAGCGACCGGATGAGCGCCTTCTCTGGCG
GCGGGTCCATGAAATCAAAGTTCAGCAGGTCGTTCACGCCCAGCGACTTCATCAGCAGCACCACGCTGCCGAGGTTCGTGCGCTGGATCTCCGGCACTGT
GTTCTCGTCCAGTTCGTTCTTGTACGACCACGCAGTGTACAACCGGAAGCACTTGCCAGGCGCGGTTCGTCCTGCTCGACCCGCGCGCTGGTTCGCCATT
GCCTGCGACACTGGTGCCACCAGTAGCGACTCCATGCCCGTCTGCGCGTTATAGTTGGTCTGTTTGCAGAAGCCCGTGTCGATCACGTAGCAGATGCCCG
GGATCGTCAGAGATGTCTCGGCGATGTTCGTACTCAGCACCACTTTGCGCGCACCAGGTGGTGTGGGCTCGAACACTTGCGCCTGGCGCTCCGACGGCAG
CGTCGCATATATCGGCCGGATCAGCAGCTCTCGTATCCGCGAGCCCAGCCCTCGCGTGCGTT