Description :
From Genome Similarity Track
Location :
Scaffold_1370:1103- 2551
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1370-snap-gene-0.7Calcineurin-like phosphoesterase

Sequence
1448 bases(100 bases per row)
CGGGTTGCGAATGCTGCTCTGCACGCCATGGACGCACGCGAGGTACTCGCCTTTGGTCGTCCACCACTTCATCGAGCAGAGCGTGTTGGCGCGACAGAGG
TCGGACGCGCACGGCTCGAAGCGCTTGGACTGCGCGCGCATGTTTGCGTAGTACGCGTCCAGCAGCGTCCCGTTGGTCTTGGCGCGCTCGTAGAATTCGG
TTAGGTCCGACGTTGTCAGCGACTTGAGGCCATACGCTCTATCACAGTACACATGATAACTCAGTATGACAACCAAGCAAGCACATGTATGTGCCGCACT
GGACTTACTCGCTGCCTTTGAAGAGCCGCTGCCAGTCGAGCTTCTGGTTCTTTCCCGAGATGTGCGTTCCGTAGACCATGAAGTCCACGACCTCGTATGT
GTCGGCGTCGTAATCCCAGACCATGAACGACGGGTTGGTGGTGAAGTAGGGCGAGATCGAGCCCGAGACGAAGAGTGAAATGAGCTGAAAGCCCTCGTCC
GCACTTGAACTAGCACTTAAAGCGCGCGGCTTGGCTGGCAAGATGCGCATTTCGACGCTCTGCACGTGACCGAAGAGCTGTGCCTTGACCACGTCCGGAT
ACTTGCCGACGATCTTCTTGTAGCGCTCGATGTAGCTCACCTACCACTGCGGCTCCGTGTCGAACGAGTCGACGATAGGCGGGATGTGACCCGTGATGTA
CACGAACCTGCCCTGCTGCTTGAGGCCTTCGAGCGTCGTTTCGAGCCACACAAACTGGCCGAACGGGTCCTCGACGGCCTGTGTATTTGGCGCGTGCTTG
GGCTGAAAGGTGCAGACATTGGGAACAGCCAGTTGACAATGACCAAGATGCATTTGTTGATGTATCTATCATGGCTCAATGTACTGCGTAGGGGATCGTA
TTGAGCGTGAGTACAAGAAGCCTATCGTCCAGCTCGTAGGAGAAATACCCGCGGCGGTTGAAATTCGTAAAGTCAGAGGCCGAGAGCGTGTCGTTCCAGG
CGCTCGAGACCTTGGCGATCGTCGGATTTGCGTCCACGTCCGGATTCGTCAGCTCCATGTAGTAGTTCGGGTCTAACACACACAGCACAAGATTAGGTTG
TTCATCATTTAACTTGGATCAGTGTATGCACGTACTCGCGTCGTTGTTGCCCAGAATCGCCGTGGTCTCGCGCATGTGCGTGCTGTTGGGCGAGAAGTAC
TTGTGCATGGTCTGGACGTTCACCTCGACCGCCTTGGCCACGTACGCATCTGAGAACACGCCGTGGGCTACGTGATCGCCCGTGTGCAGGAACAGATCGG
GCTCTGGGAGCACCAGCTGCGCGTACTGAAGCGCGGACTCGAGTAGCGTCACGGGCGCGTCCTGGCCGTAGTGAAACGGCATCATAGCCGAGTCGGCGGC
GTCGAGCGAGAGCGAGAGGTTGAGGTGCACGTCCGAGAAGTGCAGGAT