Description :
From Genome Similarity Track
Location :
Scaffold_2881:1103- 2247
Transcript NameFunction/comments
Phypl_g15460Avr4-associated TDF-like protein

Sequence
1144 bases(100 bases per row)
CATCTGGCAAGACCCGACCTCAGTTCATTTTCAGTTTTGCACGCCGCCGAGTACTCCAGTTTCCAGTGCCAAGCGCGCTATGAAGCTGTTCTCGCCAATC
ACCGCTGCATTCGCCCTCCTTGCCGCAGGCTCTAGCGCCCTTACAGAGGAGACCAAAACGCTCAATGAGCTGTACGAAGACGCCGTTGCAGAAGGTGGCA
AGCTCATCTTCTACCACGGAGGTGACCTTGCCAACCAGCAAGACTCGCTCAAAACTGCCTTCGAAGACGCCTTCCCCGGCATCAACCTGACCATGGTGGT
GGACTACAGCAAGTACCACGACGTGCGTGTCGACAACCAGCTCGAGACCGACACGCTCGTGCCGGATatcacggcgctgcagaccgTGCAGAACTTCCCC
CGCTGGGCCAAGGCTGGTGACCTGCTCGAGTACAAGCCGGCCAACTTTTCCAAGATCTACGACGGCCTCAAGGACGAGAGCGGTGCGTGGTTCGCGTACG
GTGTGAACTCCTTCAGCTACATCTACGACTCGAGTAACCTCGGCGGTTTGGCGCCCAAGTCGCCGGCTGATCTGGTAGACCCCCAGTGGGCTGGTAAGAT
TGCCTCGTCCTACcctcacgacgacgacgccgtgctcttTGTCTATCACCTCTACGTGGAGCAATACGGTTGGGACTGGGTCGCCGCTATGGCCAACCAG
AGCATCAGCTTCAACCGTGGCTCGCACGTCGCCAACAACCTGGTGACCGCCCAAGAGAAGGTCATCGGCGTCGGCACCTACGCTGGCGCTCCTCCGATCG
TGTATGTGGGCGGCAATGGCACGGAGTACCTGACGTGGGGTCAGCGCATCGCCATCCTcaacaaggccaagaacCCTGCGGTCgccaagctcttcatgaa
CTGGATCCTGTCCACAGAGGTGCAGGAGTCTGTCGTGATGGAGACTGTGCGCACTGACATCGCTCCGTCTGGATCGAGCCACCCGTGGGAGATCCCGGAG
GCCAACCTGGACGAATTCCCTACTTTCATGGCAAACCGAACCAAGGTGGAAGCACTGAAGCAGACGTTTGCTCTTTACTTTGGTGAGGTGCAGGGCGAGC
CGACGCCTGGTTACCTTGGCGTCCACCCTGGCTTGTAAATGAGT