Description :
From Genome Similarity Track
Location :
Scaffold_3:1102413- 1103922
Transcript NameFunction/comments
Physo_559959predicted protein
Physo_374746Hypothetical protein

Sequence
1509 bases(100 bases per row)
CAGCTCTGCTGCCAGCCAAAGTGCGTCTCTGGTCTGCTTGACACCACGCAAGCAATGGCGGAAGAAGGAGTTCCTGACGCACCCAGACCTGGGCTACGAC
GTGCAGTCGCTTATTGCAACGCGGAATCAGTCCCCAGATACGCCAGTGTACGTCTACTGCTGCTTCAAGCGCCAAGCCATCGCGGCACTCGCTACCACTG
AGCAAGCTTCCAAACCTGAGCCTGGCACCGACACCATCGCCCGAGATGCCGCTCTTGAGACGTGGCTAGGACTGGAGACGGAATTGAATACGAGGAAGAG
TGAGCTCGGAGACCAGCTCGTTGTTATGGACAGCCCCGCCGCGCGAGTGAAGGCTGCACAAGATCAAGAGCAAGCTGTTACCGATAACCTGACTGATCCT
CGGAAAGTCTACATCCAAGCGACAGGTGAAATCTCCCGTGTTCGTAGATTCAGCAATGGCATGGCCTTCGTCTCACTGGAATTAGCTGGAAGTGGGTACG
ATAGACCACTCCAGGTTTTCTTGCAGCGTGACACACTTGGATGGTCTTTGGAGATGTTCGCAAAGGTGGTGAGTCTGCTTCGAAAGGGCGACGAGCTGGT
CGCAGTGGGATTCATGGCTCGCAACGCGCGTGGTCACTCAATGCTGCAGGTGGAAGCCTTGTCCTTGGCGCGCACAGGCGAGTTCGAAGCTTACAATTAG
ACGCGCTGGGACTCACTAGGAGCTGGAAATGGATTTAACTTTCCCTTTCGGCTCGGACTTGTGAACTGTTTAGCTGTTAGGACGAAGCCATTGGAATTGG
AAGGAGAAATCGGCTCCTGAAAGCAAAAACAAAAACAGTTTGTCAAAATTGAGCGTCTACCCCAAGGTAAGTAAGAACTTACCAAAGTGTACAACGCGAA
ACGTTAGCGTGAAGAGCATCCATAAAATGACTTTTGAGACGATCAGGGACCACTGGGTCTCCAACACAAAAGCCAATTGGTACAGCGTGCGTATCCCACA
AGATCGCTTCGTGATAATGGCAAGTGCGACGAACGACGTGAGCTCCAGCAATGCGTAAGCTAGTATTCCCGACACAGCTCTGCCCACGTTATCAGCAGTA
AGACCTTCCATCTCGGAATGATAACGAGCGCTCGGTATGGGGAGCACGAGAAGAACAGGTAATTCGTACGGCGTATGGTTCACCTTGGTGAAAAGCAGTT
GATATACCGGGTAGCCGGCATACATGACTCCAGACAGCACGATAATTTTACTAAATTGCCTCAGGTTCCTCCGCAACGAAAACATGCGTTCCCACTCTTC
CGTGCCCAGCACAACGCGCAAGCCTACACCCAAGACCAGCGCCGAAGGAGGAGAGACCGCCAGCATGAAGAAGGGCACTGGAAACACCGACACCGCCGCT
ACTGCCACTCCTACAACAACAAAGGCGCTACCAGAGTACACGTGATACGCTACCGACTGCTTTACAGATAGCGGCCGAACGTTCAACCAGAGCCCGATCT
GTGACGTGA