Description :
From Genome Similarity Track
Location :
scaffold_793:11022- 12513
Sequence
1491 bases(100 bases per row)
ACCCCGAAGAGGCCGACACACCTCGCGGTGTGTTGGAGGTACGGCTGGCAACGGGTGCCACCGTAAGAACTGAGAAGCGCGTGGTCCGTGTGCGCTTCTC
TTACAAACGAAGGACGTTTGTGGAAGATCTTATCGTCTTGGATCTAGACGATAAGTCCGACTTGGTATTAGGCATGCTGTGGCTTGCACGGCATGACCCG
ATGATCAACTGGTAGAAGCGTACGCTTGTACGCTTCAACAGCATGTGCGCGACAGAGAGCGATGGCCCTGTCAGTGCCGCGCGTGCACCGTCCGGTGCAT
GCGACTCCCCAGCTGAGGCAGCAGCAGCCGCCGCTGCCTCCGATCGCCGCCGGCGACCCTTGACGACTCCGGGAGTCGTTGAGAGAAAATGTGTTTCGAC
TCAGAAATCTGAGTCTGAGCCGAAGGGTCGCCTGACCGATCACGTGAACAAGTGTCACGTGAATGAAGGTCACCTGATTGATAATCATCTGAATGATAAT
CACTTGAGTGAAGGTCAGGTGAATGAAGTTCACCTGAGTGATGGTCACATACCGGTATTACAGGTATCCTTGGAGGTACGCGCCGACGACAGCGCGTCAG
CTCCGGGAGCTGACAAAGCCAATAGAATTCCGGTTCAGGGAACCGATAGACGTGCGTCAGCTCCGGGAACTAGCGATTGTACATCGGCTCCGGGAGCCGA
TGACACAAACAAAGAGCCGCTAGCTCCGGGGCTAGCGAAGGCACGTCGCCTCTGGGAGTCGACGATGCAATTACTCCATCAGCTCCGGGAGTTGATGGAG
GCGTGGCGGTTCCGGGAACCGACTACGCGGCAGGAGGTGCAGGCGGTTGCAAACGTCCAGCACCAGAACAACCTGCGTGCTCACGTGCAGCAGTGCTGTA
CGCGATGAGCGGCACACAAGCCGGGCTTGATTGTGCGAGTCAGCGGAAGACATCCACTGACGACTATTGCGATAACGACCCGTCCAAGGCGAAGGCCCTT
GGACGAGGAGCACCTGGAGCCGGGCTCCAGGGAAGATCTTCGCGGCGCAAGCCACAGAAGCTGCGTGAGTCTCAGTCCGGGACTGAGACGGGTGTATCTG
CCGGGCAGACACCGAGCGTCGAGACGTTGAACGTCTTGACACGTACTGGTACTGGATTGCAGTACCAGAAGATGCGGTTGGAAAGTCCGCCGACGTGTGC
GTCGGTGTTGACCGCACTTCCAACTATGAGTTGGAAGCGCTTCGCGCGGGACTGGTACGATGGACGCATCGAACAAATTTGCATTCTCTCAGACGTTGAG
AGGGTGGAACGCGAGGCCAAAGAGCTGAAGCAGCTCGTCGTTGATGGGATCACTGAGGGCGATAACCCCCTCAGTGCGAAGACCAAGAAGCAGCGCTTCG
AGGAGCAGAGTTGGGACTCGTTGAGGTCGAGTCTCTATTACGACATTCTGCGGGAGTACAAGGATGTACTTTCTGACGATATTCCTTCGGA