Description :
From Genome Similarity Track
Location :
scaffold_7:1102179- 1104430
Transcript NameFunction/comments
Plaha_PHALS_03668transient receptor potential ca2 channel (trp-cc) family protein

Sequence
2251 bases(100 bases per row)
tcGTACATAGTAGTGAACAGAGTTGTTCCACTTCGTTGGCACTTGCTGCGTTAGTTTATCATTTATTTCCTGCCGTATTGATTCTAGGTCTTCCAGCATC
AGGATTACGTATATTTGAACCATTTCGACGAGAACATCGATTTGATCAAGTTGGAAGATTGCAAAAAGTGAAACGAACAGTTTGCCTACAAGTTTGTGAG
CTTGTTGGTGTGACGATCTTTTTATATGAAGCACTCATTCTTGGTTTTACTGTCTATTACGTTGCAAGTGGTAAGATCTTTGTTGGCTGTAACTCAAACA
TTCCTGCGTATATCTTTTGTGGCTTTGCCTTTATTATGTTTTGGTTACTCTTTGTACTCATGCGAGCATTTGCTCGCTTTCGTGAACATTTAAAAATGCA
ATTGGGTGCATTTAAAGAAAGTGATCAAACGGGCGATGTCAAGGCGCATATGTTACGCTCGAAAATGAAACGtaggaaacgacaacaaagAATAAATGGT
CATTCTGATGAAGCGATGATACCATCAATCGCTGGATCGACACTTATTAAAGACATTAAAAAGCGACTATTTCGAGGCGCTCATCTAGGTGATCTCAAGC
TTTTACGTCGTTCAATTCGGATAGCCAAAGCACATCTTGGGGATACGTTTGCAGAGGATTTATATCCAGATCCTGTCATGATGTTTGGTATCTTTGGATT
CGCAAGGAAAAATCCCATGCACGTCGCGGCGTATCAAGGAAATATTGCAGCAATGGAATTATTATACAAAGCGCACTTTCGAATTAATGTGTTTGACAAA
GTGTCGCGTTGGCGATTGAGTACAGGGGATGTCTTTTGGTACCTTGCCAGTTATTTCATTCCTAAGACTGTGGTCTCTGCAGATGAAACGTATAACTCCG
TTCTCAAGACGACATTAGTGACACCATTGCATTGTGCCGTAAGTACTGGTCGGTTGGCTGCTGTACAGTGGCTCATAGCTCACGGTGCTGATGTGAATCT
TTGTTCCAAATCATCGTCTCGATGTGAAAGTCGTTTACCACCAATTTTTCTTGCAGATCATCCTGAAATTGTGCATGTATTGCTACGAAATGGTGCGAAT
CATCTCGCAATCCCTGATCCAGGTCATATGAATACAATTACAGTTCTTCAGCTTGCGTATTTACGTGGAAACTATGCCGTTGCTCAAGTGCTAGAAGATT
GGGGAGGCGATGTGGCACTTACACCACTGCACGCTGCAGCGGCGATGAATGACGTCGCAACGATTCGGAGCCTTTTGCGTAAAAAAGTAAATCCAGACGT
TTTAGGTGAGCTTGGATACGTAGGTTTGAACAAGCGAACGCCACTGCATTGGGCTGCTGTCAATGGTGCAGTAGGTGCTTTAGAAATTCTCCTAGCGGCC
GAGGCCAATGCTAACTTTCAAGATGCGCAAGGACGAACTGCTCTTCACTGGGCAGCTCGTGTTAACCGTGTAGATAGCGTAAAAGTACTGCTAGCACATG
GTGCAGACCCTACGATTGTTGATGATTGCGATATGACGCCGATTATGTGTGCGGCTTGTGCTGGAGGGACCAGTGTCGATATGTTTAAGGTGCTTGTTGC
TAGTGGTGGCGATATCAACCATCAACTTCGTGTATCAGGCGATACGGCTTTGCATTTAGCTGTGAAACTTGATGATCAACAGACTGCATTGGCACTATTG
AGTTTGGGAGGAGACATCATGCGTACGAATCACGATGGGTTTCGTCCCATTGATTGTACGACATCAACAAGACTACAATTTGAGATCAAACGTGCAGCTG
GCACACGTGATGTCATGATTAGTTATACACACTCACATATGGAGTTTGCATTGAAATTACGAAAGTCTTTAGAAGATGCAAACATTACTGTGTGGCTAGA
TCTAATGGATCCGAGTGGAATAGGAGGAGGATCTGTGTGGCGAGAAGAGATTGCACGTGGAATTACAAATGCAGCCGTTGTGCTCTGTATATTAACAGAG
GACTATACACAGTCAGAGTGGTGTCTCAAGGAATTAGCGTTAGCAAAACAAGTAGGTACTCCCAtcttggccatctcgactgaACATGCCAAGATATCAG
AAGAATTACAAGTTTACTTGTATACTCGACAGCTTGTTCCATTTGAAAGTGCCATCGTGAATGTCGAACACGTGAATGGTAAGGAAGTGCGTTACGAATA
TGATGAATTTGCGTACAAGAGGCAGTTGCGGATGTTGCTTGATGGGATGCG