Description :
From Genome Similarity Track
Location :
Scaffold_19:110217- 112866
Sequence
2649 bases(100 bases per row)
GGAGTCGAGGAAGACTCCCTATTGAGATGGTTCCTCGAAGTGGACGATGCCATTAAGGCTCGCCACATCGATGACGAAGAAATGCAAGTTGCGTTTGCCA
AATTGAATTTGTCAGGGAGTGCCAGAACTTGGGCCCTAAATCTTCAATTACACAATCCAAATACGTTTGGATCGTTGGCGGTTTTTAAGACTCTGCTCAG
CCAAACGTTTGAGCCACCAAGAGCTGAGTTCAGAAATCTTTCAGATCTCCTGAAGATAAAACAAGATAAGCGTGACGTTCACGCTTACGCTCAGCACGTT
CGTTACCTTGCAAGTAGTATGGTAGCGAACCCTTTAAGTGAATTCGTGTTGATCACGATATTCTTAAAGGGCCTCATAGATGGTCCCGTGAGGAATCACC
TATTCCGCATCGAATTGAAGTCGCTCGAGGAAGCGATCACAACTGCGGTTCAAGAGGACTTTCGTGAGACAGGCTTACACTAGCTTGACCCCCTATCGTC
CTTCGAGACGAGTAGAGGCGGGAGGTCCAGAAGCAATGGACCTCTGCAGTGTCGAGAGCGAGAGACCTCGCTCTTCAAGCAGTAAGCGATTGCACTTTTG
CAATCGCTGTCAGAAGTTAGGACACTACGCCTACGAGTGTAGTGCTTCGCGCCCAGTGTCTCGTAACACTGAGCGAAGTGATCGACCGTCTGCCAAGAAG
GGCAACGGACGCGGGTCCGACGCCGTTGCGAAGTCACAACAGCCTGGCGGACCGTCAAAAGACGGTCAGGGCCAGTAAGGGCGGAGCGCCCTACTGATCC
AGCAACCTCAATAGAATTTGCAAACCTATTGATGAAAGTTTCTCCAGACTCACAATCCTTGTGTGTCTCTGCACTTGGTGATGAGGCAACCCTCATCACC
TTGAATTTAGAAGTGACAAAAGATTTGTCACTTCGTGCCTTAGTTGACTCTGAGACATCGAACAACTTTGTTCGTCGCCAGTCGCTAGAGGCTCAAGTTC
GTTGAGCACATTACTCCTCCTACGGGGATGACGGTGCTCTTCGCAACAGGCGCATCAATAGCAGTGATAAAACGTGTAGTAGGATTTCACTACACGTTAG
AAGATTTGCAGTACAACGATGATTTTATCGTACTTGATTTGGATGAAGAATTTGATGTCATACTAGGGTTACCCTGGCTCGGAAGGTATGAGCTAAGGGT
CAGCTGGCAGCATCGAACCGTGAGATGCCTGCCACTTGTTCATCAGATGGCCACCTGATGAACGCCTTGGAGCGTTTATAAGCGTGTGGATGTATACTGC
GAGTGAGTGCGATGGCCTCACTTGCGGTACGGTCGTTAGTACGACTGCACAAGATTACAGTGTTACAACCAATCACACTGTGGAGAAAGCTGCCGGTGGA
TGTGCGGATGCACAGGCAGCGCCAAAGGTCCACCACTCGAATAAGTCGAGTGGATCGGGACATGGGTGTACGCCTAGCGGGCGACATCCAAGTAAGAATA
TACCAGTTGCCCACACAGGGCAACACGATGATCATAGATCGACTGGAGAGTCGATAGTAGAGGACCTAGCTGTGGTAGCGCAACCACAGCTAGAAGACGT
CGAGGGAATGAGTCCCCATGAACTTGAGGAAGAAATTCCTCAAGCAGATATTGGTGAGGTAACGAGACCTCATCATCCTGAGGGAATAAGTCTCCAGCAG
CCTGTGGAAAGGGTTTTCAGGAAGAAACCGAGACATTGAATGTCTTGGTTAATGACGGGTCAAGTGTTGGCGCTTATACACTTGATCTGATCACGCCTCC
GAACCTGACTTCGGATATCACCCAATTGCCAACGCAAGAACCGAAACGGATCTTGCGAGATCTGCGTAGTGGCAAGGTCAAGCAGATCTGTGTACTCGTC
ACGGAGGACGAGTACGTGACTGACTTTCGGTAAGCAGTAGTATTTGCCGAGAACGAATGGGTTCTCACCAGCTCATCAATGGACGAAAGTGTCCTCGATG
AGAAGACTCGGATTGAGCGATACACGTCTCAATCTTGGGCGTCGCTTCAGACAAATCCTTTATATAAGGATTTGATCAATTCAACGATATGTTCCCTGAA
TCCGTACCGTGCGAATCGCCTAAGGATAAAGGCACTCGACATGAAATCGCGCTCAAACCGGGATCGAAGTACTGTGCCATGAAGCAGTGGCCACTGCCTC
GTGAACAAGTACTTGCGATCGACAAGTTCTTTGCCAATCGCTTAGCTACAGGTCATGTGAGGGAGTCAACTTCCCCTTACAGCTCTCCGGCCTTCTGTGT
GAGTAAGGCCACAGGAGGATGGCGGATAGTGCACGCATTCAACAAGTTGAATGCTGCAACGGTACTAGCTCAGACGCCGAGACCGAGGAAGGACGTAATC
ATTGATGGTATGGCAAAAAGTACCATCTTTCGTCCATGGATCTGATGGATGGCACTATCAGATCCTTATGCTTGAACGAGATACCCCATTCACAGCAGTG
AGAACCCCCAGCGATATGCTCTGGAAATGGCGGGTTATGCCACAAGGGATTAGTAATGCCCCAGCCGCATTCAACAGATGCGTCACAAATCTGTTGAGAC
TGGTGCGAGATTTCGCACCGAGTTGCTTTGACGATAAATTCATCCATAG