Description :
From Genome Similarity Track
Location :
Scaffold_23:11020- 13835
Transcript NameFunction/comments
Phymu_g1482hypothetical protein
Phymu_g1483hypothetical protein

Sequence
2815 bases(100 bases per row)
TGAGCTCCTACACCCGAGGATTTCCATCGAAAACCGTTATGGTGGCGAATATCGCGCATgacgtggacgagaaagACTTGCGTTCTGTGTTCGGCTACGT
TCTGCCCATGGATATGGGACTGGAGTACGTACAGTACAATACTGATATTCTTGCTTGATGTGGAATTTGACCGTGTTTGTTTGATAAGCTCGATGGACAT
TTCACTTTTACGAGCAAAGAACTCGGCCTTAATCACTTTTCCCAACGAAGAATTGGCGATAGCAGCAGTGACCAAGCTGCACGGGGTACAACTTGAAGGC
AAAGCAATGATTGTGGTACGTAGTTGATGGGATTTTCCCAGAAGTTACTCATACTCACACAGTTTTCAGAGCTTCCACAGTTCATCGGAGACACCCCCAG
CCGTAGAGCGGTGGTCGTTGCAGGAGCTAGCAAGTAAACGCTTGCCTGAAGCTGAATTGGCATCCGAGAAGGTTatgaagaagtaccagcGTGGACAGCC
ATCCAACTCACTTTATGTGAAGAATCTGGCCAAAACAGTGGAGCTAGCAGACCTCTATGCGGTCTTTGGCGCAGTTTTGCCGTCTGACTCAAGACTGGAG
TACGTATTCAGCGGTAATGAGCGTGGCTGCGCTAGATCTAACTCTTTTGCTACCATGCAGGGTCTTGAATGTCCGCCATTTTACTACGGGGAGAATGAAG
TGTCAGGCCTTCGTGACGTATCCAGCAGTCGATCTCGCTTCAAGTGCCTTGCTTCACGTGCATGGCGTCGTGCTCAAGGATAAACCGTTGATTGTGGTAC
GTAGAACACCATCGGTAACGTGTGCATTTGATTCACATGTTAAATGTTTTCCTCCAGTGTTTTCGTAAACCCCAACCAGACTGTCCGTGACAGCTCTCCC
GTTTAAATAACACCATGGCTTTAGGGAAGCTCCCGCAACTTCGCCTCACTGATACTGTTGATCACCCACAGATAATTCACAATGATCGTCGAAGAGGCTG
TTTTGATCTGCGGCTGCGCGCTTAGCTGCCTTGTCAGCTGACGTAGTGCGATTGGATTGATCTTGTCCGACACAATGATGAGCTTCCGTGAGCGATTCTC
GTGCTTCTGCATCTCATCTGGAATATCGTCCATGAACGCGATCAGCTTCCCCCCACCCATACATATCAGAGTATGCAACTCCGCGATCGGCGGCATAGGT
GAAAGGAACTCGCCGACTACATGGAAGCAAAAGTCCGCAAACAACATTGTTCCAATGTCTGAGTGATTGACCTAGTAACATACACAAGAAACGTTAGATG
TAGATTACGAGTGGCTGTAGCAGAGAAAAACCCATACATCTGGTGGAGACAAGGCGAGGAGCTTCTCTCGCGTGAGCCGTGACCGCTTGACGGCGTCGTG
GATCCTACGTCCTTTCCAATGACCGTCGGCCTCATAATTTACTTCACTCACATAGCCACCACGAACCGCACAAGCTGTAAACAAGAGGTACAAATTCAAA
CTACAGTCAGTATCACGTtcaacaacgacaacaaaCGTCGACAGGCATACCTTGAAGCCATTCGTCGCTCACAATCCAGCGGCCGCCAACAAGAGCCTTG
AGATACTTCAGTGATCTTATCTTCACCCAACGACCAGACGCCGGTTTGCCGCCGAACTGCTTGTGGTTCCCAACTTTTTGCTTCAGAGAGGATTCATCCG
AGTCAGAATCATCCATCGAGAGAttgtcgtcctcgtccgtACCACTGCTTACACATTTAACGATCAAGTGCGTTACGTTGTTGGACCAGTGCTGAACGAT
TTCAGCCCCAAGCAGTTCCGCCCACTCCTCGATTTGCTCCATTCGAGCTTCCTTGAATCCTGAGCAGAGAAACACCATTCCCGAGTGCTTTCTAGGCGTT
GTCGGCTTCACTTTGGTCTTGACTTCCTTCTGAGGTGAAGGTTCTGTCTTCACAGTCAATAAATACGGGGAGACCATCGTGTCAGAGGGccgttggcgct
ggcgcttcctcACAGAACGACTTGGCGTCGAGTCGGAAACTAAATCCTCTGAAGGCGTTCGGATATAGAAACCAGGCACGTGATTGTCTCTTCCCCCAAT
AACAAACTTCACAGCGTAAAAGCCATCACCGTGGACCTTCGTGatacgagcagctccgccttgTTTATTGATGCCAGTCCATTGTCGTTCAATGACATTC
ACGATATCTCCGACATGGAAATCGACGATTTCAGGTAGTGGCTCAGTTTGACTGTCGACGACTAGCGAACAGGATTCTGTTGAGCCATTCTGAAGTAGTC
TCTCCCCATTAGACACCCCATTTCCCTTCGGCTCGTGCGTATTCCCACTGGTGCGAGATCGCCGCCTCTTGCGTGGCGTCTGATACGCATGTACCGCTGG
CCCCGGTTGTCCCTGTTGAGTTTCATCTTGTACAGCATCTGAACTTGACCGCCGCCGTACCGGTGTATCCTCCTCCATGGTTTCATGCACTTCTTCCAAT
TGGGTTTCAGCTATGATAGCATcatcagcaccttcatctccacgagATTGCCGCCGTCGTGGCCGAATGAATGACGCTAACTGGTTCACGTCAACTGATT
CCAACTGCGTTTCGTCCGTTGGTGTATCTGTAGTAATATCCAAATCTTCTGCGTTCGGACCaggccgccgccgccagGGCATCAGCTTGTtttcgtccac
ttcctcaTCACTTATCTCCACTATCTCCACTGTAGTCGTAGACTCCTTCTGCGCCACTGTAGACACTGGAATTTCAAATAACGCGGGCGACATCTGCGAC
GCTGCCACCTGTGAG