Description :
From Genome Similarity Track
Location :
Scaffold_1059:1102- 3821
Sequence
2719 bases(100 bases per row)
AATGTGCCGCGGCAAAACGCATGTTCTAAATGTCATCCAGTAATGTTTGTGTCTCTTCCATTGACGATAAGCGGACAGGATGCACCACGAAAGCGAAATC
GCGCTCGTCTTTGTGTTGCAGATCCACAGTATCGCTTTGTCGATCGGATAAAAGGAGCACTGTGTTTTACACGTTGTCACTTTCGTACTCGTAATCCTTG
TCATTCTCTCCGTCGAGGTGCTCACTTTCATCTGGTAAAGACTTCTCGCGACGGTCGAAAATCCTATCAGAACTTTGTGAATTGCACCCTGTGCGATCTC
TGCGGGGGTCCTCATCACTTATTGGTGCAAGATCCTCCTCAGCAGCCTTCTCCTCACTGTCAGCACTTCTTTGTCGACGCCGCGCTCGCCATGGTTGGTG
GTGTGTTATTTCTCCAGAGATGACATCACTATCGCTCGATGACGGGGTGATAGAGATCGAAGACGGTGGCCCTGAGGCACGACCGCTGTCATGCCGCTCT
CGCAGATGCGAGGTGTGCGTAGCCAAACGTCGATGACCTTAAAGTATCCCCATGCTATGGTGTGGGCTTACATCAGCATCGATTTGTGGATCCAGTTAGC
AGTAGAATTGAGATAATTTGTTTTGGTTGCAGTGGTTGATGGTGGGGTAGATTGCTTGTCGAGAAATGAGGTAAAGCATATTTGTCGAGATTGAATATTT
AAATTTGTACTCTTGGCGCCTGCGGCATAGGGCAGTCGCTTTTAGTCGTACAACGTCCAAATGTCAGCCTTCTACAAAAGACAAAAAGTAACAGTTTGGG
TCTGAAATAAATTAAGTTTCAAACATTAGAGAAGTAAAAATAAAGAATTTATTCTTTTTTTTACGCACGTGGACCCTTTTAGTATTAGTCACTATATTAC
GTCAGGTCCACCGGATTGCTTAAAGATCCATCCGTTTCGATAACGACGTCTTCCTCATCATCAGCTTGGTAGGATTCCTCCGTGAGTTTCATAATCCGAC
CCACTCTCTTCTGATTCGCTAGAGCTACTGTCGAAAGGGTCGTCAATATCCGGAGTTGATGGACCGTCTGTATCTGAGTTAGTGCCGTCTAATTCGTCAA
AATAAGTACCACTCTGTTCCATCTCAAATCGAACACTTCTCCTTTGCTGACATATTTATTAAACTAATGGTGTGATTTAGCTAAACGAGCCCACTACGGA
AAGCCCTGCCTATAAAGCAGTATTTTTTTGGTAGATCATAGTCAAACAGCAACGAAGTACAGAGCAAAAGAGCGTCATTCGTTTTGACGGGGTGGACGTC
TGGTTTCGCAGTGGGCTTCCCAGTGTTGGAAAATTGCTGAGGTTTTCAGAAGAGATCGATTTTGCTACGGTCTTACAAGATGTGAAAATAGTTCTTCAAA
AGCTGCTGTCTGTGCCGCGTTTGCCTGAAAAACGCTTTTGACCAATTACATCTATGTATTTACAATCTGACAAATTTTGGATCTCGCAAAAGGTGAAAAT
AAATAAAACAAGGTGTGTAGAAAAGAGTTCATCATAAAATAAAAGATACTAATTTTGAGTTGGTGGCCCTTCATTTTATTAAGTGTCTCCTGGCCCTTTT
TGCCAAAGGGTCGCAATTGGAAGCACTCCGTTGCGAATGTGGTGCTTCGAAACTCGGGGCAGTTTGTATGTATCACACGCAATGACAGATTCTGGTATTT
TTTGTGCTGTCAAAAAGCACTTATCTATAGTCGATCACAGTAAGTTTTTTCAGCTTCCGCAATTAAAGCATCGATCTTGTACGTTGGTGTGCGGTATTGG
AGCCGGACTGTAGCAGAGTTAACAAGACCCATTTCGAGTACGATCATATCGGGCGACTTAGCTGGCTGGTATTTGATAGCCAATGTTGACAACATCAACA
TTTGTTGTGCCTGCCGTTAGAGCGATCAGATGGCAGCACTTCATGCTTACTGTATCTGCACCAGCTACATAATACGTGTCAGCTGTAGCCACAAATTAAA
CAACCCCCCAAATCTCTATTCTTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTCGGTGGGATAATACAAACTGTTAGTTACC
TATAGAAATGCAATCCTTATTTAACCAATGGTTGGCTTTGAACGACCTTGGTACCTTGTACCAAATATCTCGGAGTATGACGTGTCATACTCCTGAAGTG
TGAAGTGTCACACTTCATCTAACCAGGGTACACTTAGGGCTACGTACCCCGTTACATCCTCCCCCACTTAGGCTCGGTTTACCGACCAATCAGAATGAAG
AGGTGTTCGTCACAAACTC