Description :
From Genome Similarity Track
Location :
Scaffold_135:1102- 2804
Transcript NameFunction/comments
Phyin_T30-4PITG_19958ATP-binding Cassette (ABC) Superfamily

Sequence
1702 bases(100 bases per row)
CCGTGCATACTCAGCTGGAACAACCTCAGTTATGCCGTGGCCACCCCCAAGCCGACCGGCATCAAAACCATCTTGGACAATGTCAGTGGCCGATGCGCAC
CCGGAGAACTCACGGCCATCATGGGCCCGTCCGGATCAGGCAAAACTACACTGGTGGACTTACTGGCCGACCGTATTAGCTCCGGAGAAGTAACAGGCGA
CATCGAGCTCAACGGCGAGGCCCGCGTGGCCAAGACGTTCCGGGCAGTGACCAGCTACGTGGCCCAGGAGGACTCGCTGCTCGGCTCCTTCACCGTGCTG
GAAACCATGCGCATGGCCGCCAAGCTCAGTCTTCCGAACAGCGTCACGTCCAAGCAGATCGAGGCACGCGTGGACGACGTGGGTGAGGCCATGGGTCTGG
CCACGTGCCGTCACACCCTGGTAGGCGACATCTTCCGAAAGGGTCTTTCGGGCGGCCAGAAGCGCCGCCTCAGTATTGCCATCGAGTTGCTGTCGAACCC
GAGCCTCTTGATCCTGGACGAGCCCACAAGTGGCCTGGATTCGAGTGCCACGCACAACGTCATGAAGTTCATCGTGAAGCTGTGTGCCGAGGGCAAAACC
ATTGTATGTACGATCCACCAGCCATCATCGCTGGTGTACGACATGTTTACGAACGTGGTGGTGCTGTCGGCTGGCCAGACTGTGTACTGCGGTCCTCGTC
GTCTGATGATCCCGCACTTTGCGTCGGCCGGTCACGACTGCCCCACGTACATGAACCCGGCCGAGTACTTTATCAGTCTAGTGAACACGGACTTCGAGGA
CCACGCGAATGTGTCCAAACTGATGCAGTCTTACGCTCAGAGTGAGATCCGCAAGGAGCTGAGCGACCGCATCGAAAGTGACCGCAACACGTTACAGCAT
CTGCCGGACATCGAGCAGCCGTCGCCGTCCGCGATGCGTCAGTTCAGCGTTCTCATGTACCGCAACACGCTCAACAATATCCGCAACCCCGGAATCTACT
GGATCCGGTTGTTCATGTACTTCTGCTTGAGTTTCATGGTCGGCACCATGTACTTGAGCACGAACGACGACTTGACCGAGGAGGATCTGGTGCCACTGCT
GTTCTACGTCCAGGCGTTCCTGGTGTTCATGTCTGTGGCCGTCCTACCGTTCTTCATCGAACAGCGTGCAGTGTTCGCTCGTGAGCGTGCCAACAGCTCG
TTGAGTGTGGTGAGTTATGTGTGCGCCAACTTCTTGGCTACACTACCGGGTATCTTCCTGATTGCAGCGATGTCGACGGCTCTAGTGGTGCTTCTGGCGG
GTCTGAACGCGTTCGAGTATTTCCTATTGAACCTGTTCCTGTCACTGGTAGTGGCCGAGTCGATGATGCACCTGCCGTCCCGCACTATATTATCGGTATC
GCGTTGGGTGCCGGCGTGTTCGGTATGTTCATGTTGTGTGAGGGTTTCATGGTTCCTCGTGACTCAATCCCGGACTACTGGATCTGGGGCTACTACCTGG
CGTTCCACTCGTACTCGTTCGAGTCGTTCGTGTTCAAGCAGTTCGAGAACGAGACGTCGGACGCGGCAAAGGGAATTCTGACGAAATACGGCATGGAGGA
TGTGGACGTCTCGCGAGATATGATTATTTTGATCGTATATATCGTGGGATTCCAGGCCATTTTCGCGGTAATATTGTGGAAATTCCACACTGGTCGTCGT
TA