Description :
From Genome Similarity Track
Location :
Scaffold_595:1102- 2763
Transcript NameFunction/comments
Hyaar_Emoy2814364hypothetical protein
Hyaar_Emoy2814365mannitol dehydrogenase

Sequence
1661 bases(100 bases per row)
ACTACAGTAGCTGCGGGTGCTGGTCAGACTGTGACCAATAACCCGCCAATCGACACCACTAGTGGTGGGAAACGGCCTCGTCTCAAGATGACACTGGCCA
CGATGTTCAAAAACATCCACGGCGTATGGGCGGTCTTGCCGAAGGGGAATCTCACACATTATGTGTGCAGTGGGACCGTGATGATCATCAGCTGCTACAT
TCACAAGGCAAGGACGCAACTTTTCTACAGAAGTTACTTAGCACAACATCATCGTTGTCAGATGGCGAACGGACAGAATGTTATTCACACACGAATCCGC
AAGCTAGAGTCACCCCTTCAGCATCGTCGGACGTCACGGCCTGCACATTAACATGGTAAATCTAGCGTACTTAAGCAATGCACGGTTTATACATGCACTA
CTCCCACCACGATCCAGCCACCGACGGTGGTGCACACGTTAGTGAAAGATGATGGTGAAAGGTATGCGGTTCTTTTTAGCCTTTACCACGAAGCGTTTCC
CTCCTTCCACACTCGCACCGACACCCGAAGTACGCATAATGAATGGCACAAATACCTTGTTCATCTGCTCTAAGATATGCAAATGATGGACTCTTCAACA
ACCTATTGGCGTTTGGTGCTGAGTCAACGAAGTATACTGAGCTCGTGCATTCGCAAGAACTATTATTATCATGATCGTTTGACACAGCGACGTTGCAAAC
GGGGTAGGATGTGGTCTGCTTTCGATTCGGCCCTTCTTCGTGAGAAAGCCATTGTTCTGCAAGGTGTGCCACTTCATCATGGACAGCACCACGAAGCTAC
AAACCTCTTCATCCATACCCTGGAGCTTCTGGTTCGTGGCTCGGTGAACTAGTCCAAGGAACAAAAACAAGACGTTGAGATCGGGTCGTGATCAAGCGCA
AAAAGAGTAATAGGTTGCTAATAACTTGTGCAAGCAGCTCGTCGTCCTCCGCAATCGATTCGTTCGCTCAACGCGTCTGCGCTTCTCTTTATCCCAATAC
CAAAGGCGAAGACTACCCGTTATGTCTAAGAAAGATACATAAGGAGCTACTGGACGAAGACCATGTATTTTGTGCACGTGGCGACCCGCTTTAATATGCT
ACTAGCCGCTAGAATAGATACTGCACGCGCAAGACCAATTGTGTCTTTGATCGGCGTGTCGACTTGGTCAACACAGTCGACTTCTCGGCTGAGTTAGTGT
ATGTTATAGAGGTCGTTGATCAATTACACACGCTTTTCATGGGTAGCTCGCCTGCCATAATGGCAAAATTTAACTTTTAGGGAGCAGCTAATGAGCCTTC
AGTTTTCGCTATTGAGCCTTCTTCCCATGAGTTCTCCGACTCCGGGTACCCTAGCCACTTTACCAGATACTGGTACTGGCCATGGCGACGAAGTCGTTTC
AGGAGTCTCTCCACGTGGAACTGGCGGTTCTCTTTCTCATCGAGCAGCGTCGGTGGGGGCCGGTGTACCGAAGAAGGAGCATGAAAAGGTACTTTTCGAG
CTGAATGGTCTCCGTGAGACATTGGGTAAGACCCAGAGTGCTCTCGACGCGACGCAAGCTCACGTTCAGGCGTTGGAGTCGGGTCACACCCGGATGGAGG
CCCAGCTTAACCTCCTGATTCGGATTCAGCAACCGATGGCAAGGCCAACTTTCGCGGCGCA