Description :
From Genome Similarity Track
Location :
Scaffold_1798:1102- 2231
Transcript NameFunction/comments
Phyag_g11501hypothetical protein PHYSODRAFT_498916

Sequence
1129 bases(100 bases per row)
TTATCATTTATTCCTCGTACATatccctcctcctcccctCCAGATTGCCATATAGATAGCCATGttcgacggcagcttcaagtctTCGCGCAAAGTGAAC
CTCAGCGGCCGGAAGAAGCCCACGACGGGCTACAGCGCGCGTCTGGCGTCTCGCTCAGGCGCCAGAGGTcggtcggagctgctggcgggcTCGAAAGAgg
agctgatgctgcagaaccgACTGGCCAGGGAGGAACGACACGCTCTGAAGCAGCGCACAACCGCCAGCACGAAGATCCAGGCCCAGTACCGACGTCTGAG
AGCCGCAGAGCAGGCCAGAGCGAGCGTgttcgagcagctggagacggatCTGGCGCAGGTTGCGATGACGGGGGAGATCCAGACGCGACCGCTGGCCACG
CACCAATTGGAGCTCTTCCTGAGGCGATTTCTGTTCGTGAGAACGACAAGTTCGGGTGCCAATGGAGTGGTACAAGACAGGATACGCAAAGTGCAGGATT
ATTTGGTGTTTATGCTGCTCATGAGCTGTTTAAAAGGGAGCAAAGGAGAAGGGACGAATTTTCTagagatgcagcagaaggatgCGACGTGGGTATATCA
AGTTACCAAGGTGAGCGAGATTGCGTTGCAGACTTTAGTGCAGGAAGAGTTAGAGACGTCGGGCACGAATGCTGCGATTGCGGTGAACCCGTAtttactg
ctgctggacacaCTGACGAGTGGAACGAAGTATCCGACGGTGGAAGATCAAGCGGCGTTGGCTAGCGTGCTGTATCACCTTGGAGTCACGGCGAAGTACG
GTGCTTTTGATGCGGTGAGTGCGTGTATCGCTCAACAGGCGAAGGAGGACGTATCTCGAGTGGGGAATGACCGTTTGGTGCAAGTGATTGCTAGTATCGC
CGCTCAAACGTTGAGATTGGCGGTGCGAGGTGAACAGGATCGAGCTGCCAGGGTATTTCGACAGTTTGCGAAGAAAATCTTGCGAtcagcgtcggcagca
agCTGTCCCATTACGAGTTATGTGACGACTATGGCTTTGTCAACAGAGCAGCTTGCTGGCGCAGAAAAAGCTAAGACACTAGGACACTTTTGGGCGTCTG
TGGTACAGCATCTTCGCGATAGTCCTGAC