Description :
From Genome Similarity Track
Location :
Scaffold_7:110173- 111582
Transcript NameFunction/comments
Physo_516577predicted protein
Physo_518013Hypothetical protein

Sequence
1409 bases(100 bases per row)
GAGAGTCTTCCGGTGTTCGAGGACGCCCAAGCTGACGGAACGCTGCACCTCGACGCTTTGGACTTTGGCCGACGTGCCGCCGTGGAGCGAGAGCTGGCCA
ACTCGGACGTGGTCTCCAATTGCGTGTTCGACGAGTCAGGCCATTTCATCTTGTACCCTACGCTGGCTGGTATCAAGGTGTTGAACATCGAGACGAACAA
GGTTGTGAAGGTGCTGGGTAAGGTAGAAAGCTCGGACCGCTTCCTGCGGCTGAGTCTGTTCCAAGGGAAGCCCAAGGTCAACACGCAGTTCGAGAAGCAC
CTGAAGGCTGCGTCTGGACTCAAGCACGAAGCCGAGGTCATGTCCGACTCCGCAAATGAGCGCGACAACATCGACCCGACACTGTTCTGCACGTCATTCA
AGCGTAACCGCTTCTTTCTGTTCTCATCTCGTGAGCCCGAGGAGGACGAGGGCGAAGACGGCAGCGCTGGTGCCGGCCGCGACGTTTTCAACGAGAAGCC
AACGCTCGAGGAGGCGCAGGTGGCCACGGAGTCCAGCACGTCCAAGGTGCTTGGTGAGACGGCAGTCATGCACACGACGATGGGAGATATCACGCTCAAG
CTCTTCGGCAAGGAGTGCCCCAAGACCGTGGAAAACTTCTGCACTCACGCGCGCAACGGGTACTACGACAACCTCATCTTCCATCGTGTGATCAAAAACT
TCATGGTGCAAACCGGTGATCCGCTGGGAGATGGCACGGGTGGCGAGTCCATTTGGGGCGGCGAGTTCGAGGACGAATTCCACCGCAGCTTGCGACACGA
TCGGCCGTTCACACTTTCGATGGCCAACGCTGGTCCGGGTACCAACGGCTCGCAGTTTTTCATTACGACCGTACCGACCCCGTGGCTGGACAACAAGCAC
ACTGTGTTCGGCCGCGTCGAGCAGGGTAAGGATACTGTCTCAAACATCGAAAGCGCGCGCGTGGACAAGTCCGACAAGCCTCTCAAGGACATCAAGATTA
TTAACATTGATATCTTCTAGGTCAGGGAGCTCTGGATCCATCGGTTGATGATGCTACAGGAAAAATACACTCAATGGATGAAGACAGCTTCGAACTAGGC
TGGAGATGTCGCTGGGTTCCCGCTTTCTATTGCGTTGCCGATTGTACCAGTACCTCCAGCGGTGGCGCTGCTACTGTTATCGTTGTTACCAGCATTCGCT
GCCAGTGCGAGTGCCGCAGTGTCGCTCAAGCTCTTCAACCGGTCGCCGCAGAGAAAGTGGCGGTAGATCTGTTGACGAGCGCGCAGCCACTCGAGACGGT
TTGCAGCTTGGTGCGTGACGTAGCGGAAGCAGATGCGGCCAGCAGCGGGGATGGTGTTGGTTTGGTACATGGAGTAGATGATGAGGACGGTGGACCGCGT
GCTGTCGAT