Description :
From Genome Similarity Track
Location :
Scaffold_6:110160- 111293
Transcript NameFunction/comments
Hyaar_Emoy2801245hypothetical protein

Sequence
1133 bases(100 bases per row)
CTACAGGGCGATGGTTGAGCACGGCCGTTGAATTAGCCGGTGAGAAATGACCAACGATATAGGTTTTTTATGTGTATCACATTAACCTTAGTATGCTAGG
ACGTGGGGTATTTTTTATTTTCCTACTTTTGAAATTATATTGCATGGCAAGGAAATGTAGAAAAAATCGACAAGATGTGAGCACTGCTGCCACAAACCAA
GAATGTCGGCTATGAAGCCGTTCATAATAGTTGCCATTTGTTTATACAGCTTCTTATAATCGCAAAATCTGCAATATTGTTGGTGCGCTCGTGATTGTGT
TCAGCGCGACTAATCTCGATTTTCCAGCAGCGTTCTTCCCCGAACTCCCGTGCGATGATGCACCATGGGTACCCAAGTAGATGGGTACCTGTGCTGAGAA
TACCGTGATCTGCCGCTCTATACTTTCCTCCATGGCTGCAACCAAGCCATACATTTTTCGCTTCGAACTACCAACTTTGCATGGGAGCGACTCAACGCAA
AAAACTTCTGCATTCGCAGCTTTCTCTACAGCAATCTGTATATCACCAAGATTATCATAAGCATCCATTATAGTAAGTGTTGCAACAAAAGAAATGATAA
AAATGTTCACCAAGGTACGAGTTTTGTAGCGGAGCTACCCTTTCTTCTTTGTCAGAAAAAGACTTCTAGACTCATAGATTCTCTTATTATATTATACTAT
ATGATTATATTTTTTAGAGTCTTAAGTCTTCACAAACGAAATGGTACTCAACTATAGGTATCTAAACGAGCTCGCAAGCTTCTAGTCCTGGTTCAGGGGA
CTACAGACCACAAGTAATCTTGTGGCACTAATGCAAAGGGGTACTAGCCTTAATGCAGGCTCTTAACTCTTACGACCAAATATTTTTTAGCAAGACATGT
GTCTTTTAAATGATCAAAAGGGTAACTAAACTTAAGTAATGACTTATAGTAATAATAAACCTCATCTACATATTTAACCTTTACACTAATATTACATAAT
CTAGGAATCCTAATAATAGGTTCTTCCGGTGTTACAACACCAGAACGACGACGTCCTTACAACCCCTTTTACGATAGATACCATATAGCCGTAATCAATA
AGGTACGGTATTACGGCTTAGCGTCATACTGGT