Description :
From Genome Similarity Track
Location :
Scaffold_84:110148- 111906
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18379hypothetical protein
Phypa_INRA-310PPTG_18380hypothetical protein

Sequence
1758 bases(100 bases per row)
CAACCGATGTGGAGCAAAGCAGAGAGCGAGACTGGAACACTGCGTATCAATTGTCTGATACACTCCAAGCACCAAAACGAGGTAACAAGAGGCCCGGAAC
AGTAGTAAACCTTATTGTAAATATCGTCTACAACGGAGCGGAGAGCACGCAGTATACACAGCCATCGAGTCTCATACACACCACTGAAACCCCACCATTT
CTTCCTCCTTTTGTCACTAAATCCCTCGTTTGGCCCGAGCGTGAGGAGAAGAAAGAGGTCAGCAAACAACATACAAACACACTCGGACGAGGTTTACCCC
CTACTTGAAGCCCCAACTGCCTAATCGAAGAGATCCCTTACAATAGGGACCTCCTCACTCTTGTCTAGGGTTACAGGCAGCCCATCAGACCACCTCATGT
CGATCGCAGTGCGCATAATGCTCAAGTTATATGCAAAGTGCCACTCCGCCCCACGTGAACAATACAAACAAACCGGTACACTACGTCCCAGATCTCCACC
GCCCATCGATTTTGCGCCAAGGAGGCTCCAACCCCCCCCCCTCTCCACTCCACACCGGCAGTCACAAGGGCCCAGACGACGTACACACCCACCCTGACTC
CCCTGAAGCATGACCTTGAGTCATGAAGTCCCCGCACGCACGCTGTCACTCGCTATAAAGTCTTCATCATCAGCCGCCATCGAATAGAAATCTGCAAATG
CTTCGACTATGAAACTAGAAACCTGACTAATCGAATTGGAGATAGCCATTTTGGAGTGTAGTGCAAACTACTAGGTTCAGGATCTAAAATCCTTGAATCA
AGGACCTTGCTTCGATCACTATTGCGAACTACAAGGTACGTCTTCACATTAAAAGTGGTGACAATATACGTACAAGGTTTCACAGAGCGTTGCTATGCTA
ACATGTCAACAGCGTGCTGTTAGTTGAAGTGGATGAGCCAATTAGAAATCCAAGAGCAATCTGCTGCTGTACATGAGATTTGACGATGGTATATACGCGG
CGTCGGCTGTTCCGAAATCCAAACCAAGACCGTACTTTTACAGGATCATTTCTATAGTACCTTCTTTTCTACTTGACTTTCCTAGTAGACAACCTCATTA
ACTTTGATGATCGTATTCGACTTCATTCATTGACTCGGGATGTCGGTGGTTGCAGTGCTGAGTTCTCTTTTGAACTTGGTCTCCCCCATTGATGAACGTC
CGCTGTCGCTATTCCAAGGCAGCGTGAGTGAGTGGAGTGATATGAGAAGTTAGTGATTCTTCCTCTTCACACTATTATTTTTTACTTTTAGCTCGTTTTC
TTTAGTAGCTTATCTTCCTCACTGTCACAATCTACGTCAGTATCACTTTTCCGCTACAACAATGTTGTAACGACATGCCCCCTGGCACGATCGGCTCTTG
AACAGCATCACTTTTGACAGTACCACCACGTTGTAAGAGTTAGTTAGAGTGAAATAGACTGATAAATGGGATTTAGTTCTCCTACATGCATGCAGTTCAT
TGTTCTTCTGCCAGTAGTTCTTTGATCTCTATTGAGGAATGGGTGTGGTTCTCGAGAATCTCGATGTTCGGAAAATCGGATCAGATGTAGCCATATCGAA
GCGACACGTCAGTTGAATCCTGTAGGGGGCCATGTCCGAGGTTGTCGCCTTCCCAGCCTTGGCGAGAGCCAAGAAGCTGTTTCTGCTTCGAAAACAAGCA
GCAAGACGACGTGAAGGAGAATGTCGTGTAGACCCTCGAAGTCGCGACGTCTCGAGCT