Description :
From Genome Similarity Track
Location :
Scaffold_126:110111- 117387
Transcript NameFunction/comments
Phyin_T30-4PITG_20233Voltage-gated Ion Channel (VIC) Superfamily

Sequence
7276 bases(100 bases per row)
GAGGGGCTGTCGCTTACCGCGACGCCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTAGACTTCTCCAGTCCGGTCAAGCAGGGGCGGGGGTGCCCTT
GTACGAGTACGAGTACTCGGCGCCTCCCGAGAGCCACTCTCGAGTGAGTGCTCCGACTGCGGGTCCGACACAGAACCCTGAGGTTGACCGCCTCCGTCAA
CGTGTCCTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATTAGGGCGAGCTCGCTCGTCTTGCGGGCCGCC
TGGACCTGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGACTGGATCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCTTTTCGCATGATCCGACGGAT
CGAGGCTTTGTTGCCACGTCCGGAGCCGCCTGCGGGCACACTCCTAGACGTACGCGTATGGTGCGTACTCGGCGTACTCAGCGTACTGTGCGTATGGCGC
CGGGGTCCGTTCGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCCGACGACCTCGTCAACG
ACTGTGACCGGCCCTCGCTTCGAGGAGCTGGGTCAAGGGGGATCTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCGACATAGAA
CGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACTATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGCTTG
TTGCTGCCGACAGAGCTGACAGTGTCAAGAGGTAGGTTCCTCGTGTCTAGCAACACAAAGTCCCCCACTTTAAATATACTTAATTTTCCTCTTCCATGTT
TGTCGGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGGACCCTGCTGACAACGCTCAGCTTGGTATCCATAAAGGATTCCACTTGTT
TCCGCAGCGAAACTGGTCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCAAGCCTCTCCTCCACTTAGAATAGAGGAGTCAGTGTCTCCTTCGAAGAG
TGAGAGGCACTCTGGGGTGACGGAAGTTATTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTATAAG
CTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTCTGGCCGTCTGTCTGTGGATGA
TCCGCTGTGGACATCTGCAGACGAGTTCCCAGTAAAAGAAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCG
GGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTAATAGTGACGGGAACTGGAGTAAGATGTACCATCTTGCTCAG
CCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAGTCAGCCGGTACG
GGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCGCATGTCTTAACGTACCGAGCGACCCACTTGTACATGTGGG
TCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCTAAGTGGCCGCTGGAGGGCGCGTCATGCGCCTCCGCGAGGATGTCGAACTTTAG
ATCCTCGTCGTTGAGTACGACCGCTCGTGGAGGATCAGTTGGCTCCACCCGGTAATAGAGGAGGCCCTCCTTCAACTCATATCGGTGGAGCCGTGAGCGC
TGTCGCAACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCATAAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCCATGCGTATCC
GATCACATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTA
TTCGACGCGGAAGTTGTATTCCGCGAAGGAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCT
GTGTAGATCCCAAGGGCCTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCGTGGACAGGGTAGTTCCG
CTCGGCGGCTTTGGGCTGCCTGGACTGGAACGAGTTGACTCGTTCGTGTCCAGCCGTGCCGGCCTGCAGCAATGCACATCCGATGGCGTAATCGGAGGCA
CCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCGCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTT
GCTTCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGTTGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCC
AACCACTTTCGAAGATCCCTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGC
AACCGAAAACTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATTACGTCCAACACTCGACGGAGGTGTCC
TAGATGCACCTCCATGGCCGTCTTGCCTTCCTCGACACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAAGGCGGAACAAT
TGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGA
GCGGGATGTCGCTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAACACATC
CTTTCGTGGGATTGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAGCCAGACGCCACTTTCCGTTCGGCTTACGAACGCAGAAA
GTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAG
GCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGAGAGCTGGGTCGGTGGGTGTTTGTTCAC
CACGTCCGCATACTCCGTCACCAAAGGATACACCGGATCCTTGGGGTTCTTGAGAATCTCAGAACCCAAGCGCGCCTGACGCTGCTTGTTCATATCTTCT
AGGACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGGTCTCAGGTCACATAAGTACCATCTCAGCAATCTCTCCAGCCTTGAGGTTGG
TCAGGAAAGACTCAGCCGTCATTTCCTCGAGGTGCAGTATCTCTGCAACATCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTTACGAGTAAGCCGGT
CTCGCCATCGAAGATGTGATAACACTCTTCCGCCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCAAATCGAAG
TTCGGATCCGACTTGAGGCGGCGGCGGCGTCGCTGCCGACGGCGGCTGTGATGGGGAGCTCTGCTGCCCACGTTTAGGGATGTCGTCGCTACGACATCCG
AGGCACTCGTGGCCTCGTGTGGTACTGTGGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGT
GTTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTTTCA
GTGTTCATGACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCGCCTGTGGACCTAAGTTACCCACTTGGCCAGCGCCTTTTCTGGGCGCGGCCACCATCA
AAACATCCTCGGAGTCGTCAAATACGTCGACGACTCCCAAGCACCTGCCGGATGCTTTGGTACCCTGGCAGCCCTTGCGGGCGTCCCGGGTCCTGACAGA
GGTGGGAACATGACTCACCAATGTCCTATCGGACTGCGCAGGGCGGCTGGCACCGATTGACTTGCCTCACCAGTCGATCCAGGGCTCGTGCTGCTCAAGC
CAGGGCATGCCCAGGATCATATCAAAAGGATCCATATCGAGCACAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACGGCCAGATCCACTTGGA
CGTTGGAGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCTCAAAGCATCGGACAACTTGTTGCTGTTACG
AGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCGATCAAGATTCTAAAGGGATGATCGTATCCCCGTACACATCCGTGTACTACGAGC
AACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCTCGTGGTACGCGCCACCTGCGCACCCATCACGAAGACTTAGTT
CTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCGGCGTTCCCCTGTCCCCGGGATCCTGGATTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAG
GACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTAAAGTGGCCCATATTTCCACAGCCGAAGCAGCGGATGTCACGCTGTTCGGCGGACCTGAGTT
CCATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGATGGCTGTACTC
TTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGCTTGACTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCCACTCGAAGGCCGTCCATGAGCACA
GTCATCTTGATGTGTTCGCTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCAGCTCGCGCCTTCCTTGTTTAC
ACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGAAGCTGTTCGCACAGCTGAGCACAGGATGTGAAACATCCAGG
GGAGGTTGCTTCCCGTGTGTACACCCAACTCTTAGCACGGCCGCTAAGGTTGGAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAGAGCCGCG
TCCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTAGCCTTCAGCCGTATTGGCTTCGGGTGAGGCG
GATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCGAGCTGCTCAGC
CGGTGTTGACACCACCAGGCTCTGCAGGGCTTCCATCCCGAAGATGCCAGTCATCTTCCGAACCGACTCGAACTGAGAGTCGTTCATATGGGAGAAGTCG
TTCCTATCCATGGCAACGAACTTCGGAGAGGTTCAGGCAGTCTACCCGCGGTGGCGTGGATTGACTACAAGTGCTACCAAGTGTGACGGGGTCACACAGC
ACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTAGTTAAAGAGAGCGAAGTGACCCAA
ATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGGGTTTAATATAAACTATAAGTTACCTATAGAAATGCAATCTGTGAACGACCTT
GGTACCTTGTACCAAATATCCCGGAGTATGACGTGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATGTAACCAGGGTACACTTAGGGCTACGTACCC
CGTTACAAGATCCATGGCACGACTGCGTAGAAAGGGCCGATTACGGTCGTTGGAGCAATAAAATACTGTGCGATGAGCAGACGATTTAAAATTACCCCCC
CCAACCTCTTTCTATTCACTCTGCGCGTATGGTAGCTATGAAACACGGTAGGCAGAGTTGGAGGAAAAGCTAAAAGGGCGCAAAATTTGCCCTTTTACAA
GCCCATTTTCCACCTTGTTTTGGTAATGGTGCTAAAGGGCGAAAAATGCACCGCGAAAGGGTTAAAATGGACGCTGGTTTATCCCAAGATAGAGGGAAGT
CGGTTTCAGACTCCTAGACAGTGGGGGTACTGTGTCAGTGAGGAACGACACAAAACTGGAGGGTATACGGTCACCTGGACTAGAAGAATCTGCATGGTAG
AGCATTAACCAGGTCAATAGAGAAAGCATGAGCATGATCAGCGGGTATACAGTGAGGCGGGTGGAGGGTAATAGTGTTTTATCCCAAGGCCGACCACGAT
CAATGATCGGTGCGTCAGCTGGTCGGCGAGCATCCCAGCAAGGCACTGATGCACTTTCACTGGAGAATCGAGACAAACTGTTGCTGAATGAAGAGACTAC
GGACGCTTTTGACCCAAGTTGTCTAGTCATCAAGGCGTGGGAACACATTCTCCTACTTTGTTTGCTCTACGAAGGATTCGTCGTTCCGTATTTTCTCGCA
TTCCAACCAGAAGCAGTTGGCGGAATGAATTTGAAATTTGCGCTAGCCGTCGTGTGCGAAGTGATGTTCTTTATTGACTGCTACGTACAAGCAAGTACAG
GATACTATGAAGACGGGAACCTCATTCGCGACAAGAAATTAACCCGAAGACGATATTTCCGCTCGTACCGTTTTGCTATCGACCTGGTAGCAATCTTACC
GTGGCAAGTCTGCGCGCTTCACAGCCCATATGTATTGACAAGGCTCTCGTTACTTAAGTATGCGCGATGTTGGCGGCTCAACCAGTTCGTGACGAGTCTG
GACGAGTTGTATGCAAAATATTTCGTCACGCTAAAACTGTTTAAAGTTTTGCTATCCATGGTATACATGGCACACA