Description :
From Genome Similarity Track
Location :
Scaffold_6:1100708- 1102389
Sequence
1681 bases(100 bases per row)
CACTTCCTCTGTGCATTGTGCTGTGTGACCCCGTCACACTTAGTAGCACTAGTAGTCAATCCTACGCCTACGCGGGTAGATTGGTCTACCGGAATCCTCG
GTGGCTCAGGTCTGAGAGCCACGATGGACCGCAGTGAGTTTCCTCACTTGACTGACTCGCAGTTCGAGTCGGTGCGAAAGATGGCGGGCATCTTCGGAAG
AGATGCCCTCCGGAGCTTGACGGCGGCGACGCCAGCCGAGCAGGTCGAGCGGGTGAGCGCGTTTGACGAGTACGAACGCGGGCGCATCGCTCATGTGCAG
GGAAACCTGCTGGCTCAGATAAGTGAGCCCAAACGGGTGCAGCCTAAGCCTCTGCGGCTAGCTGTGCCTCCGTTCGAAGGGAAGGAACGTGAGAACCTTC
ACTTCTGGATCCGGGACACCGAGATCGCAATGAGCGCAGGTCTCATCTCGGCCGAGAACCTTCGAGTCGCCTTCGCGCTCTCCAATCTTGGCGGACGTGC
CAGGACTTGGGCGTATACGCGCGAAGCGATGTCGCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCTTTTCTCCCGGCGAAC
AACGAGTTCCGCCAGCGCTCGCGCTTCCTTGCCTGCAAACAAGGGGAGCGCGAGCTGTACGCGTACATACAGGAGATGTGCACGTTGGTAACCTCGCTGG
TGGGGAACCCACTGTCAGAAGACGTCAAGATGACAGTCTTCGTGGACGGCCTGAAGGTCGGTCATGCGCGCACGCAGTTGTTCCGCGTGCGCACCGCCAC
TGTGGAGGAGGCGATCCAAGTCGCTCTCCAGGAAGAGTACAGCCACAAGCAGGCTGTTGCTCTGGCTGTTGTACAGCCTGTGGTCGCTGACAGCGAACCA
GAACCCATGGATCTGAGTTCGGCTGAGCAGTACTCAGCCCGCTGCTACGGCTGCGGCGGACTAGGACACTATCAACGTGTCTGCCCATCGCCTGGGTCTG
GGAAGAAAACCTACCCGAAGACCAGAGGGTCAACGGGGCGCCGACGCCATGCACCGTCAGGTGCTCAAGGGGGACACAACCACCAGTAAGGACGAGGGCC
TTGCTGGGGTTGGCCCGAGTCTTTGTGATGGGTGTACGGAAGGCGTACACCACAGAGACCCGGGGTCCCTTGCGAGCACTGACGCTCGCATTGGTGAAGG
ACAACGGTGGGTTGTCGGTAGTACACGTGAGTGTGCGGGGGTAATGGTATCCCTAGACATGATTGAGTCTCGGACGTCGCGTGGATGTTCGCACGTCGCC
AGATGTGTCGGTTGGAATAACGACACAAGTGCCGAGACTCTGCGAGAGAGTCAAAGCACAAGGTCAGGTCTCATTGACTGAGGCTGGGCCGAAGAAGAAC
CTTGGGGTCCGCTGTGACCCTGGCTGCCGCGCTCGAGGGCGCTGACAGCAATGGAACCGCACATGGTCCCGGACATGGAACCGTACATCGTCCCGGACAT
CGTGCCGAAGCCGGCCCTGGGCATGGAACCGTATATGCCCTCGGCTTGAGCAAGTATGACTTGGCCCTGAGTACGCCGTGCAAGCTGCACAGGCTCTCGG
TCGAGTAGCGCGACACCGCCTTGAGGCTAAGTCGGCCCTCTGTGTCTGACAGAGCATTGGTGAGTCATGTTCCCACCTCTG