Description :
From Genome Similarity Track
Location :
contig_111:110045- 114327
Transcript NameFunction/comments
g13202.t1hypothetical protein

Sequence
4282 bases(100 bases per row)
TGACGGAGGGCAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGA
GGTGACGGAAGTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACG
ACCGAGGAGGTGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGA
CGGAGGGCAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGT
GACGGAAGTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACC
GAGGAGGTGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGG
AGGGCAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGAC
GGAAGTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAG
GAGGTGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGG
GCAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGA
AGTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAG
GTGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCA
AGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGT
GACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTG
CCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGA
AGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGAC
CACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCG
TCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGC
CCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCAC
CGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCC
ACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCCA
AGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCGA
GACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCACG
AGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGGGCAAGAAGCCCAAGTCG
AAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCGAGACGG
TCGAGACGACCGACGTCAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAGTGACCACCGACTGAGACGACCGAGGGAGGTGCCGTCCACGAGCGA
GGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGTCGAAG
AAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCGAGACGGTCG
AGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCACGAGCGAGGT
GACGGTCGAGACGTGGACGACCGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCC
CAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACC
GAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCA
CGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCCAA
GTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCGAG
ACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCACGA
GCGAGAGTGACGGTGACGACGAGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAG
CCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCA
CCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTC
CACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCC
AAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCG
AGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCAC
GAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAG
TCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGA