Description :
From Genome Similarity Track
Location :
contig_111:110042- 114327
Transcript NameFunction/comments
g13722.t1hypothetical protein

Sequence
4285 bases(100 bases per row)
AGGTGACGGAGGGCAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCAC
GGAGGTGACGGAAGTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAG
ACGACCGAGGAGGTGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGG
TGACGGAGGGCAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGA
GGTGACGGAAGTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACG
ACCGAGGAGGTGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGA
CGGAGGGCAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGT
GACGGAAGTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACC
GAGGAGGTGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGG
AGGGCAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGAC
GGAAGTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAG
GAGGTGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGG
GCAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGA
AGTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAG
GTGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCA
AGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGT
GACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTG
CCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGA
AGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGAC
CACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCG
TCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGC
CCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCAC
CGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCC
ACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGGGCAAGAAGCCCAAG
TCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCGAGA
CGGTCGAGACGACCGACGTCAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAGTGACCACCGACTGAGACGACCGAGGGAGGTGCCGTCCACGAG
CGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGTCG
AAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCGAGACGG
TCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCACGAGCGA
GGTGACGGTCGAGACGTGGACGACCGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAA
GCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACC
ACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGT
CCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCC
CAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACC
GAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCA
CGAGCGAGAGTGACGGTGACGACGAGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAG
AAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGA
CCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCC
GTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAG
CCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCA
CCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTC
CACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCC
AAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGA