Description :
From Genome Similarity Track
Location :
Scaffold_367:11000- 12780
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_367-fgenesh-gene-0.6Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_367-fgenesh-gene-0.15Glutamine cyclotransferase

Sequence
1780 bases(100 bases per row)
TCAGCTGGCCAGCTGGTCTACAGCGACGTGGTACAAGCATATATAGGTGTCGCAGTCGGAGACCTCAAGAATCGGTTCTTAACCTATATTTTGGTTTGTA
ACAAGTTATTTTACTATGATTGGTCGAAATTGCGATCGGGTATCAATGGCGCTCCACCAATGCTGGAAGCGTCGCGCGGGTCATAAAAGCAAGGACGCTG
AGCCGTTGAAAGTAGCCGCAGCACTTGGCACTTGTGCGCGCGTGTGTATCTCTCTCCTCTCTCTCTTTCCATTCGATTTACCCCAATGGCGCCGACGAAG
CGACTGAACCTGAGCAGCAAGTCCAAGGACGACGAGTCGTCGTCTGCGTCCTCGAGCGACGAGGAGGAGCGCGTGGTCTCGGAGCAGGAAGAGCAGTCGC
AGTCCGAAGACGAGTCCGATGAGTACGTTCAATGCGCTCTATTGCTGATATCACAACGACTACTGGGCGCTCACGTAATATGTGTGTGTGCTGTATATTG
TGCCTAAAATTGGTACAGGGAGTTTGAGATTCCTCCAGGGTTCGAGCCTGTGAAGGGAAGCGCCGGTGTGACCCGCGAGACCGTGCTCTCGGACGACAAG
GAGCTCTGGTTTTTTAAGCTGCCCAAAAACGTACGTGTGCGTTAGTCTGCCAACAATGTCAAGTTTAAAGTATAAAACTGACATCTTCTTTCCCTTAAAT
TCGTGCAGATGGACGCGTCTGCGTTGGCGAATGTGACGTTCAAGGTCGGCTCGAAAGGCGAACTCGGCGATGTGGTCGCCAAGGTCTCGCGCGACGACAA
GAAGTACCAGCTCCAGCACGAAGACGTGGTGCTCACGCACCAGTTGGTGAACGCGCTCCCAGAGGCGACGGACCGCAAGAAGTTTTCGCTCGGCAAGCCG
TTCTCGCGCGTGTTTTCGCTTATCGAAGACCGAAGCAGCGGCGCCGAGACCAAGTCGCACAAGTCGAGCAAGAGCAGCAAGCGAGAAGCGTCAGTAGAAG
ACGAGGAGAAGCACCACAAGAGCAGCAAGAAGAGCAAAAGCAGCAAGGACGACGCGAAAGCTGCCAAGAAGGCTGCCAAGGCCGCCAAGAAAGAGAAAAA
CTGATAGACCCCACTGACTGGCCCTTCCGTATGCGATAGACTCAAGAGCTCATGTCGAACACACGACAAGCTCATACTCACAACTTTGCATTCTAATTAA
TATTTTCTGTTCCATGTCGACGTGTATTTGGCCCCTAGGACAGGGGAAAAGTTATGGAAAATGGCATAAAATCCTTAGTTACACGACACCAATGTCTGGA
TTCATGGCAGACCACAGCAATGCTGTAAATGGGATATGCAGTGTGGATGTATCGACAGTTTGTATTGTTTATAATGGATTGACCTTAACAAAATGATGGA
TGAAAGAGATACAACCAGCTTCAAATGACAAATAGCACAACCTTAGCCCAGCAAACGCACTTTGTAGACCGTGTTCCAGAGCTTCCCCGTGACGTAAAAC
ACGTCTTCATCGGCATCATACGCGATGCCATTGAGCACAGCATTGTGGTCCCCACGCGTGATGCTTGGGTCCATCAACTGCGCGCAGTCAAACACCGACA
CGATGTCGCCGCTGTGCGGGTCGATCTTCACGATCACGGCCTGGAACCAGATGTTCGCGTAGATGAAGCCGTTCGCAAACTCGATTTCGTTCAGCTGCGA
GATCGCGCGGTTCTGGAAGCGCACATCGATGCGGCGCACCTCGCGCATCGTTTTCGGGTCCCAGAACATGATCGTCGACG