Description :
From Genome Similarity Track
Location :
Scaffold_357:1100- 6832
Sequence
5732 bases(100 bases per row)
AACTGGATGCTGATCCACTCGATCGCCGCAGCCTTCGTCACGAGGTGGACGCTGCCAGTCTCAGTGGCGACGACCGCGAGCAGGATCTGGAGAACCAGCG
CCTGAGTGTGCTCGTCCGCGAGGTCGGACGCGAAGAAGCTCATGAGGATCGACAGCACGTGGCGACGCACGAGCAGCAGTACGTCCGAGTCTTCACACAC
GCCGCGTCGGAGTGTGTGCAGCAGCCACGAGCGCTCCTGCTTGTAGGTGAGCGGCGCGCGGCTGTTGAAGAGCGAGTAGAACATCGGCACGTCGCTCAGG
TCAAGCGCGGGACGCGCGAGCAGGAAGTGGTTCACGTGCGGGTACAACGTGTGCGCGGGGCGACACAGCACCGAGACGGCGTCGTTCAGGAACACGGTGA
CGACCGACGGAGCGGGCTCCAGTGGCTCCGCTATCGCGCTGCGGAACACATCCAGCAGCAAGTGGATCTGACGACCGGCCTTGAACTCGGACGATGATGC
ATCTGTGGCCGCCAAACTCTCGTGCATGTGTGCGAGGATGCCGAACGCATAGCTGCGGATGTGCTCGTCATTCGATGATGTCGCGCGGAGAGCAACGCCA
AGCAGCCCTTGCTGGACGAAGGCGTCGTTCGGGAGATCCGAGGCAGCCATGAAGTGGGACAGCATCGGGAGCAGGTACGCTGGGTCGTACGCGAGCTGCA
CTCCATGCTCGAGGTGTTGCTGCGCGTGCTTCGTCCATCTAGCTCCATCGATGCCAACGTGATTGCCGTCATCGTCACTGGCGTCTCCTAAAACACTCTG
CCAACTGAGCAAGGACTGGTCGCTCGATGAAGCTCCGTTCCGATCAAGCGGGAAGTTCTCAACAGTAGCACGCACGCGGCCCTGGTCAAGCCCTCCATTC
ACGATCCACAGCACATCCTCGACCAAATCCGATCGAGACACCGCTGATGGAGCAACCGCCGATGACGAGGCCGATGCGCCAAAGCGGAAGCCCACCCTCA
CTAGCGAAAGGTCCGCGGAGTGCTGCTCCATGTGCGCCAGAAGAGCGCGGAGACACCGATCAGCCGTCGACAGCGACATGGTGTATGCACCGAGGAGCGT
CTGGAACAGGGCTGCCTGGTAGCTATCAGCGCGATCCACCAGACCCGCAACCACGCGCACCAGCAACACTCTCACAGTCTCGTTCTCGTGATCCGACAAG
TAGGCACTGAAGCTACCATGAGTGGTAATGGCAGCCAAATGCGCCGCGAAGTCGTAAACTTGACTGGGTTCCGCATCCGCAGGAGCTGCTGCCACTAGAC
GCAGAAGAACGGCTGACAACTCCACAAAGCTCCGGAAAGCGACGGCGTCACTATTTGTCTTGACGAAAGCCACCACATCGCGGAACTGCGCGAGCGACTT
GGTCAGCGTGATAGAAGCATCGAAGCCATGGCTCGCCAACAGCTCGTCCGTAATGAGACGAACTGCAGTGCAGACTTGAAGAGCGACAGAGCTCGACTTC
GTGAGTGCTACCACGCCACATCGAATCAAAAACACCACCAGATTGACAACACTCGAGCTGTGTGAAGCACGGAAGCCTGACTTCACCAGCAAAAGGACGC
ACGTGATCTGGTCGCGCGTCAGGTCAGCACCACTCGGGTACTTCGCCACCAATCGCTTGCAGATTCCGTCGAACAGTTCTGCGGACACCAACTCATCGTC
ACGACTCGAAGCGATCAAATGTCGAAGCAACGACAAGCGGATACGGTCGATCTGTCCTCCCTTGTGCTGCGTCAGAATCGATTCGAAGCAGTCCGCAACC
AACGAGCGCGCGAACGACTGCAATTGCACGGTTCGAACGTGACCAAACACGTCAAAGCAAGCGTTCACGAGCATGTACGAGACTGGTTTGTGTGCCGGCT
GCTGCAGCTGCGCCAGCAAGACAGTCTCCAACTTGTCCAAAAACACCCCACCATCGTCGGAAATGACAGCCACAACACGCTGCGGAATCAGTGGTGTGAG
CGAGCGATCCTGGTCGAGAAGGGAGGCAGCTTCTTCGAGGACAGCCGGCACGATCGTGGCTTCGATGGCTTGCTCAAATACGTCACTGGTAACGCCGCCC
ATCATTCGAAGCAGCTGAAGACCAGCAACAAAAACGTCGAGAGATTGACGACGGTGTTTCTTGCCACCGTTCATCCTGGTCTCCAAGAACTGCCACAGAC
GATTGCGAACGTGGCTTGAACGGACCAGCGACTGGCTCGGACTAGCGTCGTCTTGGCATAAATACTGAATCGTGTGTTCAATCAGCGCGCGACGGACTGG
CTTCGAGAACGTATTCACCGAACAACGCAAGAGGTGCTCCAGCACGGCAAGCCGAACAGTACCACGCTCGTCCGATACGGCGCGAAGGACGAGCAGCGGC
ACCATCGCGGATCGGACCAGCGCTGGAGACCAACGTGCACTGGCGAACTCACGATCGCCATCAAGAGACATGGATTGCTTGATGACGGTCACTTGGATGG
CGGTCAATCGGTACCGCAGAAATGACGCGTTGTTCTTTGAGTCTGGAGCAAGCTGCTGAGCCAGTGCATGCAACTTGGCTACGCGCTTCTGTACTGCCAT
CGATGAAGCACCGCTCGACGCGACAATAAACGTCAGCAGCACAAGCAGGAGGTTGAACAAAGGCAGGATCTCTTTCTCGGATACTTGATCGTAATGACGC
GCGAAGAAGAACAGCAGCTGGTCAGACATTTGCGCAGCGTCAGAACCATCCAGCAGCGACTCGTGATCCTTCTGCGTCACCAGCTCGACAATGCTCGAGG
TGCATGAAACAATCGCCTCGGAGTTGATCGCAGTTGCAGAGGTGACTTGACTCTTGGTTCCGATCCGGTAAAGCAGGTTCTGGAGGAGGATCTGCGGTGG
CAGCGAACGCACAAACGGATGCGACGCGTTTGATGGAACACTTTCGCGACCAGACTTCTTCGTCTTTTTCACAGTCGTGGACCCGGCGCTGGAAGCCGAC
GCTGAGATAAGCGGCAGAACGTCGGCATCTCCGTGAGCGAGCAAGTAATGGTAGCACAGCTCGAACGAACCGGTCACTGCCAGACAGTTATCCGCGATCT
CTTTCCAGCTAGGTCCGTACGCAGATGCGTCCAATGACGCAAGCTGCTTCTTCAAGTCCATGATGCTCGTACACCTTTTCCACTTCGTAACAACCGGCGA
ATCACTCACACGAGACTTCTTCTTGTGGCTGCTGGGAGCCGAGTCCTTCGGAGCGAATTGCTCCCGACAGTAACGCTGGATCCACGAGTATGCGTTGTCC
ACGTCAGCGGACACCCCATCGCTATCTGCGCTCTTCTTCCCAGCTCGCTTGCGTTTCTTCGAACTAGATCCATCATCACTCGTGTCATCATCCGTAATCG
TGACGTCTTCACTCAACTGAGCGTCATCGCTCGCGATCAACAGGACAATCTGTTCAGGGATCTCACAGCTGTACAACAGAGCCATCAACACTCGGACGGC
AAACAGAGTAACCTCGGCGTCAGCGTGGAACTGCGAGATCAGTCCATCCGTGGCAGTGTCTCCACGTGAATTCAGAAAGCGAACCAACGCGACAGTGACA
GGACTGACTGCCATCTTGTCAAAGTTCGCTTGACCACCCGCTTGCGAACGCATCGACTGATACGCAGCGACACTGGCGAAAGGATCAACGGAGACCACTT
GCACCAGCTCTTCCAAGAAGTGCGCACCTTGCTTCCCACTGTTGTGCAAACTCTGCAACCAAAATCTGATCTCTTCGTTCTCGTCGATGCCTTGCTCGCC
AGGTTGACCAAACACACCGGAGATCCACAGTACGCGAGTCAGCACCTGGTCGCACAGGTCACGAATCATTCGGCTCTGTGTGTTCACATCTAACAGCAAG
AGCAGCAGCAGCTTCGACGGAGTTGGCGCAACGCTCGAGCCTCCTCGTTGCAGAAGAAACCGAAGACGACTGGTATCCACCGCCAGCAGGAAGCGCAGCA
TCTCGGCAACAATCATGCTCTGCAACGACGGACGTCCGTTTGAGTTGTGTGTCAGCGCTGACTGGTGCTTGTCATCATCCTCCAAGTACTGCCACGCCAG
CAACTTGGTGAAGTCGAGCTTCACCTCGCTCATCATTTGCGGGAAACACTCGAGGTACAGTCGGAAGACGGAGAGCGCGCGAATGTAGATGAGCGCAACA
GGCTGAGTCGACGAGCACAGCTTCAACAGCAATGACACAAGCGCCTCGGGACTTGGCAGCAAGAACCGCATCTCATTCTCCAGCTCCGTCTTGACGCGAT
CAGACTGCGTTGACAGAATCACGTGCTCAAAGCGATGCAGAATCGACTCGATGACGCCGAGCGAGGAGTACACAACCAGGTCATTCACGTGCTGGATGCC
GCGCGACAGTTCTTTCCGGAAATTGCAAGGCGCGATGAGTCGCGTCGCAAGGAGTTGCGGCGTGCACCAAACAGATTCGGCCATGTCATCCGGCAGACCA
CTGGCCGCAAGAGAGCACGAGAGGAGCTTCTGCACGAGCGAGGCCACGCAAAACCATCGATACGCGGCGCGTGGCTCCAACTGGATCGCCAACGCACTCA
AGTAGTCTGCTGTAGCAGCCGGGTACGTCGTGAGCAACTTGGTCACGACAGCCTGGGCGTGCGAGCTCCGCATCAATTCATTCACACCGACCCCCACAAG
CGTGTTCCGGATGACTTTCGTCGCGTTGACTTGGTCGAACGATGTGCCGGTCGATGGCGTCGAGGCTTTGGAGAGGAACAAACGACACGCGGTTTCCGTC
GCGACACCGTACAGAGCGTCGTCTCCGAAGAAAAGACGATCCAGCATCTGAGCGGCCAAGGCAGCCACAGGCTCTTCCTCCGACTGCAGCAGCGGCAGCA
GCAACAGGATGTTCGGTCCGCTGAAGATGACAGTCTTTGCGCGATGATCCAAGCTCGGGTTCCTCAGCACGAGCTCCTCCAGCTTCGAGAACAGCAGCGT
CAGTAGCTCAGGCGAGTCAGCTTCGATGCTTTTGAACAGCGAGACGGCGATGCCACCCTCTTTCAGCGCGAACCGACGGACGCTTGTGTCAGGACACGCC
ATCAGCTCCAGCACCAGACGCACGTACGCCTCACGGATCTGAAACGCTGGTGCTTGCGGTCGAGCCTTCTCTTGGCCCTCATCTTCCTCTGTATCGGCGT
TGTCGCCCACTGGCTCGGGTTTCTTCATGCGGCGTGCCGCCATCTTGACGAACACGGGACTCTGCAGGTGGAACAGCCGCACGAACTCGCGCGCCACGAC
TCCGTTCACCGCGACCAGCGCGCGGCACAGCTCGAGCGCGCGGAACTCGATGATCGGCTTGTCGCTCCACGTCATCACCTTCTCGACCAGCGCGCTCTTG
TCGCGGATGACCTTGAGCGCCAGCGCCTCGGCCGCCTTCGCATCGCGACCAGTCTGCGCCGTCACAAGCGCCGCGAGCACCTCGAGGAAGACAGCCACGC
TCTCGCGCTGCTCCCATCGCGTGCCGGCGCCGACAGTCTCGGGCCAGCAGCGCAGCAGCGGTTCGCACTGCGGGTGGATGGCGAGGAAGCGCTCAGCCGA
GGATGGAGTGGCCAATGCTGGCGCCAAGCTGCGGATCGCGGCGTCCAGCGGCTGCTTGGCGTGCTCCACGGTCAGCAGGAACTCGCGCAGCACGGCTGCG
GACTCCGCGTCCGCCATTGTGACGGTGGTTGG