Description :
From Genome Similarity Track
Location :
Scaffold_656:1100- 2450
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_656-snap-gene-0.5Voltage-gated Ion Channel (VIC) Superfamily

Sequence
1350 bases(100 bases per row)
CGCAACGCGCTGGATCCACAGTCGTCGTTCATCAAAGCGTGGCACCAGGTTCTGCTTGCAGGTGTGATCTTCGAGTTCTTCATCATCCCGTTCGTGTTCA
CATTCAAGCCACATGCAGCGGTGAAGGAGACATCCGAAGTTTTGGTCTTCTACGCGTGGGAGACACTGTTCCTGCTGGACTTTTACGTGAAGCTCAACAC
GGGCTTCTACGAGGATGGAAACGTGCATCGAGACCTGCGCAGAGCGCGGATCAAGTACCTGAAGTCGGTCGAGTTTTTGATGGACGTAGTGAGCATCTTC
CCATACTCGCTGCTTCCAGTCCACCTGAAAGCATCGCCAATAGTTCTCGAGATTCCCAAGATTGTTCGGCTGTGGAGGCTTCCGAAATACCTCACGAACC
TCGACAACCTTTACGCCAAGCACTTTAAGGTCCTCAAGCTATCCAAGCTCTTGGTTGGCATCATCCTGGTCTCCCACTCGGTGGCATGCGTCCGCTTCGC
GTTTGGATATGATGTCCACCATTACAATCACTGGCTTCCCCATGTTCCAGAGCACGAACAATCTCCGCGAAGCAAGTACTTAATGTCCCTGTTCTGGGCA
TTTGGGATCCTCTCGGGGCTCTTCGAAGGCGAGCTGCCGCACACAATCGCTGAGTTCATCTTCACCATCATTGTCGCTCTGTGCGGCTTCTCGATCTTCA
CATCCCTTTGCGCCACGTTCTTCATGCTCTCCAAGTGCGAAAGCGGCGAAACAGAAGCTGCTGAAGGGCGCATCAACCAGCTGAAGCACATTCTCGAGTT
TCATCGAGTAAATGAAAATCTGCAAGTCCAAGCCGTGGAGTACTTGAGAGTAAGTCAAATTGTTTCCTTGCTCTCTTTGATGACGCCCCTGCTGTACCGC
TGCTAACCAGCTTGTCTTGTGAGCAGCTTTATTACACTGATGCAGACTCGAACGAGCGCGAGGTAATGAAGCTACTGTGTCCCTCGATCGCCACGGACAT
CCAGATTGAGCTCATGAAAGACACCGTCGGAAGAGTGCCGTTGTTCTTGGGGTGCAGTGAAGAGTTCGTCGTTGCCTTGACAAGTCTTCTCGAACGGATA
TCGCTCCCAGCTCAATGCACACTGTTTCAAGCTGGTGACTTTGGAGATGCGATGTACATCATTCACTCTGGAGTTCTCGATGTGATCGTCGCCAAAGCGA
AAGTTCGCGAGCTTCGGAAGAATGATTTTGTGGGCGAACTTTCACTTTTTTCCAGTAGCCCACGCACAGCCACCGTTGTAACAACAACCTACTGCGTGCT
TTACAAGCTGTCGAGATTCCACACCGAGAAAGTTTTGGACGGATACCCAC